Genex

To determine the miRNA expression profiles of ovarian cancer cell line (SKOV3) and Vero cell line (normal), we used quantitative reverse transcription-polymerase chain reaction (qRT-PCR) in two panels of sample cells. The Exiqon miRCURY LNA^TM Universal RT microRNA PCR kit was used for all experiments. The procedure was conducted according to the manufacturer’s protocol. The miRNA expression was measured with Biorad CFX 96. Results of measurement were analysis by Biorad CFX Manager^TM and GENEX software.

cDNA was prepared using 100 ng RNA from forebrain (P14 Atrx^FoxG1Cre), FANS-purified GFP⁺ OPC nuclei or from optic tracts (P20 Atrx^Sox10Cre) (RNeasy Mini kit; Qiagen Cat# 74104) and 1.5 μL of 100 ng/L of random hexamers (Integrated DNA Technologies Cat# 51-01-18-26) were diluted to a final volume of 12 μL with RNAse free water. Samples were heated at 65 °C for 10 min followed by addition of 4 µL first strand buffer (Thermo Fisher Scientific Cat# 18064014), 2 µL 100 mM DTT (Thermo Fisher Scientific Cat# 18064014), 0.8 μL 25 mM dNTPs, 0.5 μL RNaseOut (Thermo Fisher Scientific Cat# 10777019), 0.5 μL SuperScript II Reverse Transcriptase (Thermo Fisher Scientific Cat# 18064014) and 0.5 µL RNAse free water per sample. Samples were then incubated at 30 °C for 10 minutes and 42 °C for 45 min and stored at −20 °C. cDNA was amplified with iQ SYBR Green Master Mix (BioRad Cat# 1708884) using the standard curve Ct method of quantification. Experiments were performed on a Chromo-4 thermocycler (MJ Research/BioRad) and analyzed with Opticon Monitor 3 and GeneX (BioRad) software. Technical duplicates were completed for each sample. Conditions for amplification were as follows: 40 cycles of 95 °C for 10 s, 55–60 °C for 20 s, 72 °C for 30 s, and a final melting curve generated in increments of 0.5 °C per plate read. Primer sequences are listed in Supplementary Table 1.

Total RNA was isolated from liver with the RNeasy Mini Kit (QIAGEN) and reverse transcribed into cDNA as described previously [40 (link)]. Control reactions without reverse transcriptase were prepared in parallel. cDNA was amplified with gene-specific primers under the following conditions: 25–35 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute. For qRT-PCR, cDNA was amplified with iQ SYBR Green Master Mix (Bio-Rad) by using the standard curve Ct method of quantification. Experiments were performed on a Chromo-4 thermocycler (MJ Research) and analyzed with Opticon Monitor 3 and GeneX (Bio-Rad) software. Gene expression analysis was repeated in duplicate for each sample. Conditions for amplification were as follows: 35 cycles of 95°C for 10 seconds, 55°C for 20 seconds, 72°C for 30 seconds, and a final melting curve generated in increments of 0.5°C per plate read. Primer sequences are listed in Table 1.

Quantitative PCR of V-ATPase isoforms was performed with SYBR green (Applied Biosystems) and the following primers: Atp6v0a1, 5′ GGACATGATCGACTTAGAGGCCA 3′ and 5′ ACTGCTGGGTTTTTCGCAGG 3′; Atp6v0a2, 5′ CTCTGTGTACACCGGCCTCA 3′ and 5′ CTGCAAAGTCCTGCTGTGCC 3′; Atp6v0a3, 5′ GCACCAAGCAATCCACACCA 3′ and 5′ CTCAGACAGCTGGGCATGGG 3′; Atp6v0a4, 5′ TGCCGGGGAAACGTGTACTT 3′ and 5′ AGCACGAAACCCGTCACAGA 3′. Measurement of Notch1 target genes utilized the following primer pairs: Dtx1, 5′ GTGTGCCGCAAGACCAAGAA 3′ and 5′ GAGTACATGGCCACCAGGCA 3′; Ptcra, 5′ TAGCTCCTGGCTGCAACTGG 3′ and 5′ GCATCGAGGACCAGGCAAAC 3′; Hes1, 5′ TGTCAACACGACACCGGACA 3′ and 5′ TGGAATGCCGGGAGCTATCTT 3′. Notch1 was measured with the primer pair 5′ GTGCCTGCCCTTTGAGTCTT 3′ and 5′ GCGATAGGAGCCGATCTCATTG 3′. Expression analysis was performed with GENEX (BioRad).