h1RPE7/ARPE-19 cells were counted, and cell pellets containing 2×105 cells were resuspended in 1 mL RIPA solution (Cat# C500007-0010, Sangon) to perform total protein extractions. Protein samples were boiled in water for 5 min, followed by separation with 10% SDS-PAGE gel electrophoresis. The separated proteins were transferred onto poly(vinylidene fluoride) (PVDF) membranes, followed by incubation with rabbit polyclonal primary antibodies against GAPDH (ab9485, 1:800, Abcam) and p53 (ab131442, 1:800; Abcam) for at least 12 h at 4°C. The membranes were further incubated with horseradish peroxidase-labeled IgG secondary antibody (1:800, MBS435036, MyBioSource) for 2h at 22 °C. Electrochemiluminescence (ECL) substrate (Sigma-Aldrich, USA) was dropped onto the PVDF membranes to produce signals. Data were analyzed using Image J v1.46 software.
Ab131442
Manufactured by Abcam
Sourced in United Kingdom, United States, China
Ab131442 is a polyclonal antibody targeting a specific protein. It is intended for use in laboratory research applications.
Automatically generated - may contain errors
Lab products found in correlation
Ab32503, by Abcam (9 mentions)
Ab109520, by Abcam (7 mentions)
Ab8226, by Abcam (6 mentions)
Ab6721, by Abcam (6 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (6 mentions)
Ab188224, by Abcam (5 mentions)
Ab2302, by Abcam (5 mentions)
Ab182858, by Abcam (5 mentions)
Ab181602, by Abcam (5 mentions)
Ab109199, by Abcam (5 mentions)
Ab8245, by Abcam (4 mentions)
Ab32124, by Abcam (4 mentions)
Ab9485, by Abcam (3 mentions)
Ab37168, by Abcam (3 mentions)
Ab39688, by Abcam (3 mentions)
Ab205718, by Abcam (3 mentions)
Ab8227, by Abcam (3 mentions)
Ab134175, by Abcam (3 mentions)
Enhanced chemi luminescence (ecl), by Merck Group (3 mentions)
Ripa lysis buffer, by Beyotime (3 mentions)
74 protocols using ab131442
1
Quantifying GAPDH and p53 Protein Levels in h1RPE7/ARPE-19 Cells
2
ChIP Assay for Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP assay was performed as described previously [22 (link)]. The lysates of mouse liver tissues or SMMC7721 cells transfected with the p53 expression plasmid were incubated with rabbit anti-p53 antibody (Abcam, ab131442, 1:100) or immunoglobulin G from rabbit serum (Sigma, St. Louis, MO, USA). Huh-7 cells were transfected with the E2F1 expression plasmid. The lysates were incubated with rabbit anti-E2F1 antibody (Abcam, ab179445, 1:200) or immunoglobulin G from rabbit serum (Sigma, St. Louis, MO, USA). The primers used for validation the human NTCP promoter are as follows: NTCP promoter-sense: TGACAAGGGAGGAGTACAAGTAGCACCCAG; NTCP promoter-antisense: CCTCCTGTGAGGCAGTGGAAGACCACTCC. The primers used for validation of the mouse NTCP promoter are: NTCP-promoter-sense: TAGTGAAGCATGCTCAGCAGGGTAA; NTCP promoter-antisense: GACCCAGTGAAC ACCACCTC.
3
Immunohistochemical Profiling of Tumor Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sections of resected tumor tissue (4 μm thick) from the 21 patients were prepared by fixing in formalin and embedding in paraffin. Mouse monoclonal antibodies for Nrf2 (Abcam, ab‐62352), Ki‐67 (Abcam, ab‐21700), p53 (Abcam, ab‐131442), and β‐catenin (Abcam, ab‐16051) were used for staining.23 Staining results were used to separate tumors into a group with low expression of anti‐Nrf2, anti‐Ki‐67, anti‐p53 antibody, and anti‐β‐catenin (<30% of cells with positive staining) and a group with high expression (≥30% of cells with positive staining).23
4
Western Blot Analysis of HUVEC Lysates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot analysis was performed as previously described, with slight modifications [11 (link)]. Briefly, HUVEC lysates were lysed using RIPA buffer supplemented with protease inhibitor (Cell Signaling 5871S). Proteins were separated on a 10% sodium dodecyl sulfate–polyacrylamide gel, transferred to a PVDF membrane (GE Healthcare, RPN303F), and blocked in 5% bovine serum albumin (BSA) in PBS with 1% tween-20 (Sigma P2287) for 1h at RT. Primary antibodies used were: rabbit anti-phospho-Smad1/5 (1:1000, Cell Signaling 9516), rabbit anti-Akt (1:1000, Cell Signaling 9272), rabbit anti-phospho-Akt (Ser473) (1:1000, Cell Signaling 4060), rabbit anti-phospho-ERK1/2 (Thr202/Tyr204) (1:1000, Cell Signaling 4370), rabbit anti-ERK 1/2 (1:1000, Cell Signaling 4695), mouse anti-HIF1α (1:500, Novus biologicals NB100-105), mouse anti-p53 (1:1000, Abcam ab1101) and rabbit anti-p53 (1:500, Abcam ab131442). Membranes were incubated with primary antibodies diluted in 1% BSA overnight at 4°C. Signal was detected with horseradish peroxidase (HRP) anti-rabbit (1:5000, Invitrogen G-21234) or HRP anti-mouse (1:30,000, Invitrogen 81–6720), and imaged via Clarity Western ECL Substrate (Bio-Rad 170–5061). Full original blots are shown (S6 Fig ).
5
Immunohistochemical Analysis of p53 and STAT3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dorsal skin specimens from all 44 mice were harvested and fixed in 4% paraformaldehyde. These specimens were then dehydrated and embedded in paraffin and cut into 4-μm-thick sections. Sections were dried at 65°C for 30 min, soaked twice independently in xylene for 15 min, then soaked twice independently in absolute ethanol, and later soaked in three consecutive ethanol concentrations (95%, 80%, and 70% ethanol) for 5 min each. Thereafter, sections were washed with PBS and incubated in 3% H2O2 for 15 min. Sections were blocked with normal goat serum for 30 min at 37°C and drained. Thereafter, primary antibodies were added (rabbit ployclonal anti-p53 antibody 1:100, ab131442, Abcam China and rabbit monoclonal anti-STAT3 antibody 1:200, ab68153, Abcam China) and the specimens were incubated at 4°C overnight under humid conditions. Biotinylated goat anti-rabbit secondary antibody was used with 3,3'-diaminobenzidine as the chromogen, and the chromogenic reaction was terminated with distilled water after brown particles were observed and staining intensity was moderate upon microscopic observation. Thereafter, samples were counterstained with hematoxylin and eosin (HE), dehydrated with ethanol, made transparent with two independent treatments with xylene, and sealed using resin. Sample staining was evaluated microscopically.
6
Comprehensive Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Confluent cells were lysed in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 1% Igepal (MP Biomedicals), 0.5% deoxycholate (Sigma Aldrich), and 0.1% SDS with Complete Mini protease inhibitor cocktail and phosphatase inhibitor cocktail (Roche) and stored at −80°C until analyzed. A431 control cell lysate (ab7909) was purchased from Abcam. Aliquots were run on 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and blotted to Hybond-ECL membranes (GE Healthcare). Proteins were detected with primary antibodies against CAR (1:500, H-300, Santa Cruz Biotechnology Inc.), CD46 (1:500), DSG-2 (1:500), S100 (1:500, ab868, Abcam), p53 (1:500, ab131442, Abcam), EGFR (1:200, ab2430, Abcam), isocitrate dehydrogenase (wild-type IDH1, 1:600, ab94571, Abcam), IDH1 R132H (the most common IDH1 mutant, 1:500, DIA-H09, Dianova, USA), MGMT (1:1000, ab108630, Abcam), and β-actin (1:2500, C4, Santa Cruz Biotechnology). Blots were developed with anti-rabbit-Cy5 and anti-mouse-Cy3 secondary antibodies of Amersham ECL Plex Western blotting system (GE Healthcare).
7
Evaluation of p53 and Mitochondrial Oxidative Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H9c2 cells were seeded in six-well plates containing glass cover slips, in Dulbecco’s modified eagle's medium (DMEM) supplemented as described above. After 12 h, LPS (1 µg/ml) was added to the wells for 24 h, after which culture medium was removed. Cells were washed thrice with PBS and fixed in chilled methanol for 10 min. After blocking using 1% BSA solution for one-hour cells were incubated with anti-p53 (Abcam; ab131442) antibody overnight in a humidified chamber. Next, after three washes, cells were incubated with Alexa fluor 594 conjugated secondary antibodies (Thermo Fisher Scientific) for 2 h. Coverslips were then mounted using DAPI as a counterstain and viewed under a confocal imaging system (FluoView).
To quantify mitochondrial oxidative stress, cells were processed and fixed in methanol as described above, and incubated with MitoSOX (250 nM) for 10 min at 37 °C in the cell culture incubator. Subsequently, cells were washed twice with PBS and coverslips were then mounted using DAPI as a counterstain, and viewed under a confocal imaging system (FluoView). Confocal images were analyzed using Image J software for densitometric analysis.
To quantify mitochondrial oxidative stress, cells were processed and fixed in methanol as described above, and incubated with MitoSOX (250 nM) for 10 min at 37 °C in the cell culture incubator. Subsequently, cells were washed twice with PBS and coverslips were then mounted using DAPI as a counterstain, and viewed under a confocal imaging system (FluoView). Confocal images were analyzed using Image J software for densitometric analysis.
8
Western Blot Analysis of p53 and GAPDH Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiHa and C-33A were collected at 24 h after transfections, and 106 cells were mixed with 1 ml RIPA solution (Thermo Fisher Scientific) to extract total proteins. Protein samples with high quality were subjected to 10% SDS-PAGE gel electrophoresis after denaturing. After that, proteins were transferred to PVDF membranes through the semi-dry method, and 5% milk (non-fat) was used to incubate the membranes for 2 h at 22 °C. After that GAPDH (ab37168, 1:1500, Abcam) and p53 (ab131442, 1:1500, Abcam) primary rabbit polyclonal antibodies were used to incubate with the membranes overnight at 4 °C. After that, goat anti-rabbit IgG-HRP secondary antibody (MBS435036, 1:1500, MyBioSource) was used to further incubate with membranes at 22 °C for 2 h. Signals were developed using ECL (Thermo Fisher Scientific) and Image J v1.46 software was used to develop signals.
9
Progerin Regulation in Hepatocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary hepatocytes were isolated from normal rats and the model rats. Hepatocytes were lysed in lysis buffer containing protease cocktails inhibitor (Beyotime, P1005) and PMSF (Phenylmethanesulfonyl fluoride, Beyotime, ST506), as well as centrifuged at 12000 r/min, 4 °C, for 15 min. The protein expression was detected by western blot. The primary antibodies included anti-progerin (1:50, Santa Cruz, sc-81611), anti-Lamin A/C (1:2000, CST, 4777), anti-p53 (1:1000, Abcam, ab131442), anti-p21 (1:1000, Abcam, ab109199), anti-PI3K (1:1000, CST, 4249), anti-p-AKT1 (S473) (1:1000, Proteintech, 66444-1-Ig), anti-AKT1 (1:1000, CST, 2938), and anti-GAPDH (1:1000, Proteintech, 60004-1). The secondary antibodies were HRP-conjugated Affinipure Goat Anti-Mouse IgG(H + L) (1:10,000, Proteintech, SA00001-1) and HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H + L) (1:10,000, Proteintech, SA00001-2). The protein bands were visualized using the Pierce™ ECL Western Blotting Substrate (Thermo, 32106).
10
Histological Examination of Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For histologic examination, tissues were collected and fixed in 4% formaldehyde in PBS as per the standard protocol described by Sinha et al.17 (link). Briefly, the tissues were embedded in paraffin blocks, and 5-μm-thick sections prepared for respective stains after being fixed in 4% formaldehyde. Immunostaining was performed with the following primary antibodies: Ki67 1:500 (anti-rabbit, Novacastra #NCL-ki67p), B220 1:500 (anti-rat, ThermoFischer Scientific #14-0452-82), CD3 1:250 (anti-rabbit, Abcam #ab5690), p21 1:500 (anti-rabbit, Abcam #ab188224), p53 1:400 (anti-rabbit, Abcam #ab131442).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!