Total RNA was extracted with TRIZOL (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. 2μg RNA was reverse-transcribed to cDNA by stem-loop methods with the TIANScript RT Kit (Tiangen, Beijing, China). SuperReal PreMix Plus (SYBR Green) (Tiangen, Beijing, China) was used to detect the expression of the microRNAs, and the 5S was used as the internal reference. The stem-loop, forward primers, and the universal reverse primer were designed based on the sequences of rat miR-17, miR-181a, miR-34a, and 5S. The primer sequences are shown in Table 1 . For RT-qPCR analysis of Smad7, the total RNA was reverse-transcribed to cDNA using the TIANScript RT Kit (Tiangen, China). The PCR assay was implemented using SuperReal PreMix Plus (SYBR Green) (Tiangen, China), and GAPDH was used as the endogenous control gene. The primer sequences of Smad7 were as follows: forward, 5'-GGAGTCCTTTCCTCTCTC-3'; reverse, 5'-GGCTCAATGAGCATGCTTCAC-3'. The GAPDH primer sequences were as follows: forward, 5'-TCTCTGCTCCTCCCTGTTC-3'; reverse, 5'-ACACCGACCTTCACCATCT-3'. The primers were synthesized by Generay Company (Shanghai, China). PCR was performed on ABI7500 Real-Time PCR appliance. The cycling conditions were as follows: 95°C for 15 min, 95°C for 10 sec, and 60°C for 32 sec. The relative quantitative analysis of the expression was calculated using the 2−ΔΔCt method.
Tianscript rt kit
Manufactured by Tiangen Biotech
Sourced in China
The TIANScript RT Kit is a reagent kit designed for the reverse transcription of RNA to cDNA. The kit contains the necessary components, including a thermostable reverse transcriptase enzyme, to facilitate the conversion of RNA into its complementary DNA form.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (36 mentions)
Trizol, by Thermo Fisher Scientific (19 mentions)
Iq5 real time system, by Bio-Rad (7 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (7 mentions)
Sybr green, by Tiangen Biotech (6 mentions)
Rnaiso plus, by Takara Bio (6 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (6 mentions)
Trizol reagent, by Tiangen Biotech (5 mentions)
Rnaprep pure tissue kit, by Tiangen Biotech (5 mentions)
Superreal premix plus, by Tiangen Biotech (4 mentions)
Cdna synthesis kit, by Takara Bio (4 mentions)
Abi 7300 system, by Thermo Fisher Scientific (4 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (4 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (3 mentions)
Rnaprep pure cell kit, by Tiangen Biotech (3 mentions)
Sybr green pcr kit, by Takara Bio (3 mentions)
Lightcycler 96 real time pcr system, by Roche (3 mentions)
Rnaprep pure cell bacteria kit, by Tiangen Biotech (3 mentions)
126 protocols using tianscript rt kit
1
Quantification of miRNA and Smad7 Expression
2
Quantitative Real-Time PCR for Transcript Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNAprep pure Plant Kit (DP432, Tiangen). First-strand cDNA was synthesized from total RNA using TIANScript RT kits (KR104, Tiangen). And qRT-PCRs were performed using SYBR Green (FP205, Tiangen) reagents on an ABI 7500 fast real-time PCR platform. All qRT-PCRs were performed in three independent repeats, and the relative levels of transcript abundance were calculated using the 2−ΔΔCT method (Livak and Schmittgen 2001 (link)). The GmActin4 (Glyma.12G063400) was used as an internal control for data normalization. Primer sequences for candidate genes were obtained from the qPrimerDB database (Table S2
3
Quantitative Real-Time PCR Protocol for Soybean Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted by RNAiso Plus (TaKaRa, Kyoto, Japan, 9108). The first-strand cDNA was synthesized using TIANScript RT Kits (KR104; Tiangen, Beijing, China) following the manufacturer’s instructions. qRT-PCR was performed by using an ABI-7500 fast platform with the TB Green® Fast qPCR Mix (TaKaRa, Kyoto, Japan, RR430A). The program was run under the following settings: pre-denaturation at 95 °C for 30 s, followed by a 40-cycle program (95 °C, 5 s; 60 °C, 34 s; per cycle).The soybean housekeeping gene GmActin4 (GenBank accession no. AF049106) was used as the internal reference gene. The gene expression rate was calculated by the 2−ΔΔCT method. All experiments were analyzed with three technical and three biological replications. Primer sequences were listed in Table S7 .
4
Quantifying Heart Tissue RNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from 200 mg of heart tissues was extracted using RNAout reagent and reverse-transcribed using the TIANScript RT Kit (TIANGEN, Inc. Beijing, China). The primers used in this study for qRT-PCR (Table S1 , Supplementary material) were designed by the Primer Premier software 6. The reaction was performed on an ABI Quant Studio 5 Flex PCR instrument. The details of the RT-qPCR profiles are consistent with our previous report (Zhao et al., 2024) (link). The relative mRNA level was calculated using the 2−ΔΔCT method as previously reported (Li et al., 2024) (link).
5
qRT-PCR Analysis of lncRNA, miRNA, and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from the tissues (chordoma and normal) and cells (U-CH1 and JHC7) using TRIzol reagent (Invitrogen). Next, cDNA was synthesized using a TIANScript RT Kit (for lncRNA and mRNA; Tiangen Biotech, Beijing, China) or miScript II RT kit (for miRNA; Invitrogen). Thereafter, RT-qPCR reaction was manipulated on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with SYBR GreenMaster Mix kit (Vazyme, Nanjing, China). 2-ΔΔCt method was used to determine RNA levels. GAPDH and U6 were utilized as the reference controls for lncRNA/mRNA and miRNA, respectively. The primers used in experiments were presented in Table 2 .
Primers sequences used for qRT-PCR.
| Name | Primers for qRT-PCR (5′-3′) | |
|---|---|---|
| lncRNA XIST | Forward | TTACTCTCTCGGGGCTGGAA |
| Reverse | AGGGTGTTGGGGGACTAGAA | |
| miR-320d | Forward | GTATGAAAAAGCTGGGTTGAGA |
| Reverse | CAGTGCGTGTCGTGGAGT | |
| ARF6 | Forward | AACTGGTATGTGCAGCCCTC |
| Reverse | GAAAGAGGTGATGGTGGCGA | |
| GAPDH | Forward | AGAAGGCTGGGGCTCATTTG |
| Reverse | AGGGGCCATCCACAGTCTTC | |
| U6 | Forward | CTCGCTTCGGCAGCACATA |
| Reverse | CGAATTTGCGTGTCATCCT |
6
Quantitative RT-PCR Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen tissue samples or cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. A total of 1 μg of RNA was reverse transcribed using the TIANScript RT Kit (TIANGEN, Beijing, China). Quantitative real-time PCR was performed using the BIO-RAD iQ5 Real-Time System (BIO-RAD, Hercules, CA, USA) and SYBR Green (TIANGEN) as a double-stranded DNA-specific dye. We performed the cDNA synthesis using a Thermo Script RT-qPCR System (Invitrogen). Target genes were amplified with primers designed using the Primer Premier Version 5.0 software. The following protocol was used for real-time PCR: 95°C for 2 min followed by 40 cycles at 95°C for 15 sec, and then 60°C for 1 min. Standard curves were generated for each assay to produce a linear plot of threshold cycle (Ct) against log (dilution). Target gene expression was quantified using the standard curve method. Data are presented as relative Ct values (n = 6). MEG3 and TET2 expression was normalized to GAPDH, while miR-22-3p and miR-22-5p levels were normalized to U6 snRNA. The relative levels of MEG3, TET2, miR-22-3p, and miR-22-5p were calculated using the 2-ΔΔCt method [(Ct, HOTAIR - Ct, GAPDH, U6) - (Ct, HOTAIR - Ct, GAPDH, U6) control].
7
Quantifying NK Cell Activation Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in previously purified NK cells was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, USA) and 1 µg RNA was reversed transcribed using a TIANScript RT kit (Tiangen Biotech Co., Ltd., Beijing, China). The thermocycler conditions were; 50 min at 42°C, followed by 5 min at 95°C. The sequences of primers specific for perforin, granzyme B, NKG2D, NKP44 and β-actin, which were designed and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), are listed in Table II .
qPCR was performed on a Bio-Rad iQ5 Real-Time system (Bio-Rad Laboratories, Inc., USA) using a SYBR Green kit (Tiangen Biotech Co., Ltd.). The thermocycler conditions were as follows: Denaturation for 2 min at 94°C, then 40 cycles of 15 sec at 58°C for elongation followed by the annealing step of 40 sec at 72°C. β-actin was used as an internal reference gene for standardizing the expression of targeted mRNA. All reactions were performed in triplicate and single outliers, with values >5 Ct compared with the average of the remaining two Ct values discarded. The gene expression ratio was calculated using the 2−ΔΔCt method (14 (link)).
qPCR was performed on a Bio-Rad iQ5 Real-Time system (Bio-Rad Laboratories, Inc., USA) using a SYBR Green kit (Tiangen Biotech Co., Ltd.). The thermocycler conditions were as follows: Denaturation for 2 min at 94°C, then 40 cycles of 15 sec at 58°C for elongation followed by the annealing step of 40 sec at 72°C. β-actin was used as an internal reference gene for standardizing the expression of targeted mRNA. All reactions were performed in triplicate and single outliers, with values >5 Ct compared with the average of the remaining two Ct values discarded. The gene expression ratio was calculated using the 2−ΔΔCt method (14 (link)).
8
Quantifying Gene Expression in LPS-Stimulated Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR assays, RAW264.7 cells were seeded onto 6-well plates at 1 × 106 cells per well and incubated for 24 h prior to treatment. Then, the supernatant was removed and after 2 h of treatment with different concentrations of GSE0, GSE2, GSE4, and GSE6, and the cells were incubated for 24 h with LPS at a final concentration of 100 ng mL−1. Next, the cells were washed with cold PBS and total RNA was extracted with TRIzol reagent (Tiangen Biotech, Beijing, China). Isolated RNA (1.5 µg) was converted to cDNA in a 20-µL reaction volume using a TIAN Script RT Kit (Tiangen Biotech) according to the manufacturer’s instructions. The cDNAs encoding iNOS, TNF-α, IL-6 and COX-2 mRNAs were then quantified by qRT-PCR. Briefly, all reactions were performed in 96-well plates with the following procedures: pre-denaturation at 95 °C for 10 min, 45 cycles of denaturation at 95 °C for 10 s, and annealing and extension at 60 °C for 30 s. GraPDH was used as the internal reference. Sequences of the specific primers used are listed in Table 2 . Analyses of the data were performed using the 2−∆∆Ct method with GraPDH for normalization of the samples.
9
Quantifying Tumor Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The intestinal tumor tissues isolated from mice or the cell lysates of cancer cells were directly homogenized in TRIzol Reagent (Ambion, cat #15596026), then total RNA was extracted with an RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA was synthesized from RNA using the TIANScript RT Kit (TIANGEN). The relative mRNA expression levels of the target genes were quantified using the standard 2−ΔΔCt method. The oligonucleotide primers for target genes are listed in Table 2 .
10
Intestinal Epithelial Cell RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rats were anaesthetized by an intraperitoneal injection of urethane. The ileum was removed, and rinsed with saline. Then, it was placed on an ice-cold plate, and cut along the mesentery, and the mucosa was gently scraped for intestinal epithelial tissue. Total RNA was extracted from the separated cells clumps using RNAsimple Total RNA kit (Tiangen, China), according to the manufacturer's instructions. RNA concentration was spectrophotometrically quantified. The integrity of RNA was electrophoretically checked on agarose gel stained with ethidium bromide. TIANScript RT kit (Tiangen, China) was used for reverse transcription of total RNA. To quantify the cycle threshold (Ct) value, real-time PCR was performed on ABI7500 Real-Time PCR instrument (ABI, USA) using Power SYBR™ Green PCR Master Mix (ABI, USA). Sense and antisense primers used in this analysis were as follows: P-gp, 5'- AACACCCTGGTTGGTGAGAG-3' and 5'-CACCATCAAAACCAGCAATG-3'; β-actin, 5'-CCCATCTATGAGGGTTACGC-3' and 5'-TTTAATGTCACGCACGATTTC-3'. β-Actin was used for normalization.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!