Ssofast evagreen kit

Manufactured by Bio-Rad

Sourced in United States

The SsoFast EvaGreen Kit is a real-time PCR reagent designed for fast, sensitive, and specific quantification of DNA targets. It contains a proprietary hot-start DNA polymerase and EvaGreen dye, which binds to double-stranded DNA and enables fluorescent detection during the PCR process.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop 2000c, by Thermo Fisher Scientific (3 mentions) Cfx connect real time system, by Bio-Rad (3 mentions) Superscript 3, by Thermo Fisher Scientific (3 mentions) Trizol kit, by Thermo Fisher Scientific (2 mentions) Quantitect reverse transcription kit, by Qiagen (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Iscript kit, by Bio-Rad (1 mentions) Rnalater, by Qiagen (1 mentions) Anti collagen 3, by Abcam (1 mentions) Anti collagen 1, by Abcam (1 mentions) Ripa buffer, by Thermo Fisher Scientific (1 mentions) Quantitect primer, by Qiagen (1 mentions) Proteinase inhibitor cocktail, by Merck Group (1 mentions) Rnaeasy universal kit, by Qiagen (1 mentions) Iscript gdna clear cdna synthesis kit, by Bio-Rad (1 mentions) 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Rneasy plus mini kit, by Qiagen (1 mentions) Lightcycler 480, by Roche (1 mentions) Direct zol rna miniprep plus kit, by Zymo Research (1 mentions)

Close spelling variants of this product

SsoFast EvaGreen Supermix kit (124 citations) SsoFast EvaGreen (70 citations) EvaGreen (51 citations) SsoFast EvaGreen Supermix 2X Kit (8 citations) SsoFast EvaGreen Supermix with Low ROX Kit (5 citations) SsoFast EvaGreen low ROX kit (3 citations) SsoFast EvaGreen Supermix RT-PCR kit (2 citations)

13 protocols using ssofast evagreen kit

Achilles Tendon Injury and Repair Dynamics

Check if the same lab product or an alternative is used in the 5 most similar protocols

Animals were euthanized with anesthetic overdose. Achilles tendons were isolated from surrounding tissue and dissected from both sides of hind limbs. The proximal ends of the Achilles tendons were disconnected at the end of the gastrocnemius, plantaris, and soleus, and the distal ends at the calcaneus. Left leg tendons of eight control rats and six burn rats for each time point (1, 3, 7, and 14 days) were stored in RNAlater (Qiagen), whereas right leg tendons were snap frozen for protein extraction. Samples were stored in −80°C for further analysis. Tendon RNA was obtained with RNAeasy Universal kit (Qiagen). cDNA conversion was done with iScript kit (Bio-Rad), and qPCR with SsoFast Eva Green kit (Bio-Rad). Primers for IL-6, TNF, IL-1β, col1a1, col3a1, MMP9, MMP13, and TGFβ1 were purchased from QuantiTect Primers (Qiagen). Gene expression was calculated using the ΔΔCt method with 18 s as housekeeping.
For protein extraction, tendon tissue was homogenized in RIPA buffer (Invitrogen) with proteinase inhibitor cocktail (Sigma). Protein quantification was performed with BCA assay (Pierce); 10 μg of total protein was used for Western blot. Antibodies included anti-collagen I (Abcam), anti-collagen III (Abcam), goat anti-mouse HRP (Pierce), and goat anti-rabbit HRP (Pierce), which were prepared in 2% BSA. Blots were developed with ECL (Pierce) using a CCD camera system.

Hernandez P., Buller D., Mitchell T., Wright J., Liang H., Manchanda K., Welch T., Huebinger R.M., Carlson D.L., Wolf S.E, & Song J. (2018). Severe Burn-Induced Inflammation and Remodeling of Achilles Tendon in a Rat Model. Shock (Augusta, Ga.), 50(3), 346-350.

+ Open protocol

+ Expand

Quantitative Analysis of Immune Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s protocol. Purified RNA (500 ng) was reverse-transcribed using the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad). Real-time PCRs were performed with Ssofast EvaGreen kit (Bio-Rad), and data were acquired on a 7500 Fast Real-Time PCR system (Applied Biosystems). Relative mRNA expression was normalized to GAPDH, and fold induction was calculated relative to the untreated/uninfected controls using the Pfaffl method.⁵⁶ (link) Primer sequences are as follows:
PD-L1 F: CAGCAACTTCAGGGGGAGAG
PD-L1 R: TTTGCGGTATGGGGCATTGA
IFIT1 F: GCC TAT CGC CAA GAT TTA GAT GA
IFIT1 R: TTC TGG ATT TAA CCG GAC AGC
IFNα F: CGGAATTCTCTCCTGCCTGAAGGAC
IFNα R: AAGGGTACCACACAGTGATCCTGTGGAA
IFNβ F: AGC TCC AAG AAA GGA CGA ACA
IFNβ R: GCC CTG TAG GTG AGG TTG AT
GAPDH F: AATGGATTTGGACGCATTGGT
GAPDH R: TTTGCACTGGTACGTGTTGAT

El-Sayes N., Walsh S., Vito A., Reihani A., Ask K., Wan Y, & Mossman K. (2022). IFNAR blockade synergizes with oncolytic VSV to prevent virus-mediated PD-L1 expression and promote antitumor T cell activity. Molecular Therapy Oncolytics, 25, 16-30.

+ Open protocol

+ Expand

Quantitative MDM2 Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative determination of MDM2 expression levels was performed utilizing the Ssofast Evagreen kit (BioRad) with standard conditions indicated by the manufacturer at an annealing temperature of 58°C on the Roche LightCycler 480 (Roche) in a subset of 22 PA samples. Cycle threshold (C_t) values were normalized to β-actin (ACTB) and a calibrator normal brain sample with wild-type (TT) MDM2 SNP 309 genotype using the 2^−ΔΔCt method. The following primers were used:
5′-TCTCAAGCTCCGTGTTTGGTCAGT-3′, MDM2 forward
5′-ACCTTGCAACAGCTGCAGATGAAC-3′, MDM2 reverse
5′-GGCACCCAGCACAATGAAGATCAA-3′, β-actin forward 5′TAGAAGCATTTGCGGTGGACGATGGA-3′. β-actin reverse

Fontebasso A.M., Shirinian M., Khuong-Quang D.A., Bechet D., Gayden T., Kool M., De Jay N., Jacob K., Gerges N., Hutter B., Şeker-Cin H., Witt H., Montpetit A., Brunet S., Lepage P., Bourret G., Klekner A., Bognár L., Hauser P., Garami M., Farmer J.P., Montes J.L., Atkinson J., Lambert S., Kwan T., Korshunov A., Tabori U., Collins V.P., Albrecht S., Faury D., Pfister S.M., Paulus W., Hasselblatt M., Jones D.T, & Jabado N. (2015). Non-random aneuploidy specifies subgroups of pilocytic astrocytoma and correlates with older age. Oncotarget, 6(31), 31844-31856.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the Trizol kit (Invitrogen) and RNA concentration was determined by NanoDrop 2000 c (Thermo Scientific). 1 μg of total RNA from each sample was reverse transcribed into cDNA using SuperScript III (Invitrogen) and subjected to real-time PCR (Bio-Rad, CFX Connect Real-Time System) using the Ssofast EvaGreen kit (Bio-Rad). Primer oligonucleotides used for real-time PCR were as follows (Table 1).

Liu L., Liu X., Ren X., Tian Y., Chen Z., Xu X., Du Y., Jiang C., Fang Y., Liu Z., Fan B., Zhang Q., Jin G., Yang X, & Zhang X. (2016). Smad2 and Smad3 have differential sensitivity in relaying TGFβ signaling and inversely regulate early lineage specification. Scientific Reports, 6, 21602.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis of 4T1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 6 × 10⁵ 4T1 cells were seeded in Petri dishes and treated with EC 300 μM for 5 days; total RNA was extracted according to the supplier’s instructions for the Direct-zol RNA Miniprep Plus kit (R2051, Zymo Research, Irvine, CA, USA). Synthesis of cDNA was performed on 2 µg of total RNA using the QuantiTect Reverse Transcription kit and RT-qPCR (ID: 20531, Qiagen, Valencia, CA, USA), following the indications described by the supplier. Relative expression of the selected genes was determined with Biorad’s SSofast Eva Green kit on a CFX96 Touch Real-Time PCR Detection System (Biorad, Hercules, CA, USA). Oligonucleotides used are presented in Table 1.
The PCR conditions were 95 °C for 20 s, followed by 40 cycles of 15 s at 95 °C and 30 s at 60 °C. Assays were performed in triplicate, and actin mRNA was amplificated as a constitutive gene. Results were normalized to the 4T1 control by the comparative CT method (∆∆CT).

Pérez-Durán J., Luna A., Portilla A., Martínez P., Ceballos G., Ortíz-Flores M.Á., Solis-Paredes J.M, & Nájera N. (2023). (−)-Epicatechin Inhibits Metastatic-Associated Proliferation, Migration, and Invasion of Murine Breast Cancer Cells In Vitro. Molecules, 28(17), 6229.

+ Open protocol

+ Expand

Osteoblastic Transcription Factor Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

First-strand cDNA was prepared using the High capacity reverse transcription kit (Applied Biosystems, Saint Aubin, France) with 100 ng total RNA and random primers. The expression of osteoblastic transcription factor RUNX2, DLX5, iBSP, and OSTERIX was evaluated by real-time quantitative PCR with EvaGreen incorporation (SsoFast EvaGreen kit, CFX96 Real-time PCR detection system, Biorad). PCR reaction: 4 µl of reverse transcriptase diluted at 2:1 in RNAse-DNAse-free water, 1× SsoFast EvaGreen kit, 10 µmol/l of each primer and RNase-free water to a final volume of 10 µl. Three minutes preamplification at 95 °C, 40 cycles of 10” at 95 °C and 30” at 60 °C. The PPIA gene was used as a normalization control.

Prel A., Caval V., Gayon R., Ravassard P., Duthoit C., Payen E., Maouche-Chretien L., Creneguy A., Nguyen T.H., Martin N., Piver E., Sevrain R., Lamouroux L., Leboulch P., Deschaseaux F., Bouillé P., Sensébé L, & Pagès J.C. (2015). Highly efficient in vitro and in vivo delivery of functional RNAs using new versatile MS2-chimeric retrovirus-like particles. Molecular Therapy. Methods & Clinical Development, 2, 15039-.

+ Open protocol

+ Expand

Total RNA Isolation and Real-Time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the Trizol reagent (Invitrogen) and RNA concentration was determined by NanoDrop 2000 c (Thermo Scientific, Waltham, MA, USA). Overall, 1 μg of total RNA was reversely transcribed into cDNA using SuperScript III (Invitrogen) and subjected to real-time PCR (Bio-Rad, Hercules, CA, USA, CFX Connect Real-Time System) using the Ssofast EvaGreen kit (Bio-Rad). The real-time PCR primers were listed in the Supplementary Table S1.

Du Y., Liu Z., Cao X., Chen X., Chen Z., Zhang X., Zhang X, & Jiang C. (2017). Nucleosome eviction along with H3K9ac deposition enhances Sox2 binding during human neuroectodermal commitment. Cell Death and Differentiation, 24(6), 1121-1131.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Antiviral Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was isolated using the Trizol kit (Invitrogen) and RNA concentration was determined by NanoDrop 2000c (Thermo Scientific). 1 μg of total RNA from each sample was reverse transcribed into cDNA using SuperScript III (Invitrogen). Real-time PCR was performed (Bio-Rad, CFX Connect Real-Time System) using the Ssofast EvaGreen kit (Bio-Rad). Primer oligonucleotides used for qRT-PCR were as follows:

Genes	Forward primers	Reverse primers
GAPDH	ATGACATCAAGAAGGTGGTG	CATACCAGGAAATGAGCTTG
IFI6	CTGGTCTGCGATCCTGAATG	AGAGGTTCTGGGAGCTGCTG
IFIM1	ACTCCGTGAAGTCTAGGGACA	TGTCACAGAGCCGAATACCAG
IFIM3	GGTCTTCGCTGGACACCAT	TGTCCCTAGACTTCACGGAGTA
IFIT1	GAAAGCCTCAGTCTTGCAGC	CATCACCATTTGTACAAGAGCCT
IFIT2	AGCGAAGGTGTGCTTTGAGA	GAGGGTCAATGGCGTTCTGA
IFIT5	CGTCCTTCGTTATGCAGCCAAG	CCCTGTAGCAAAGTCCCATCTG
IFIH1	GGGGCATGGAGAATAACTCA	TGCCCATGTTGCTGTTATGT
ISG15	GCCTTCAGCTCTGACACC	CGAACTCATCTTTGCCAGTACA
OAS3	TCTGAGACTCACGTTTCCTGA	CACTGTTGAGGAGGGTAGAGTA
ZIKV prM	CGGAGATCTAGAAGACTGTGAC	ATGACTTTTTGGCTCGTTGAGC
ZIKV E	GATTGAAGGGCGTGTCATACTCC	TCAGTGGAACGGGGTTAGCGG
ZIKV NS5	CTGGTATATGTGGCTAGGGGC	TGGTGATTAAGAGCTTCATTCTCC
TLR3	TTGCCTTGTATCTACTTTTGGGG	TCAACACTGTTATGTTTGTGGGT

Liu L., Chen Z., Zhang X., Li S., Hui Y., Feng H., Du Y., Jin G., Zhou X, & Zhang X. (2019). Protection of ZIKV infection-induced neuropathy by abrogation of acute antiviral response in human neural progenitors. Cell Death and Differentiation, 26(12), 2607-2621.

+ Open protocol

+ Expand

Antimicrobial Activity of Zinc-Doped Magnesium Oxide Nanoparticles

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All media and reagents for microbiological analyses were purchased from Oxoid (Milan, Italy). Triton X-100, SDS, NaCl, Tris-HCl, sodium alginate, and EDTA were purchased from Sigma-Aldrich (Milan, Italy).
The AmpliTaq^® Buffer 10X, AmpliTaq^® DNA Polymerase, PCR Nucleotide Mix 10 mM and MgCl₂ 25 mM were purchased from Applied Biosystems (Milan, Italy). The SsoFast™ EvaGreen^® kit (Bio-rad, Irvine, CA, USA) and MgCl₂ 25 mM (Applied Biosystems, Milan, Italy) were employed to perform qPCR tests using the Rotor-Gene Q (Qiagen, Milan, Italy). Zn-MgO nanoparticles (Mg_1−xZn_xO, x = 0.85), with an average size from 5 to 10 nm, used in this work were a kind gift from Slavica Stankic (INSP, France). They were prepared and characterized as described previously [28 (link),29 ].
The ready-to-eat (RTE) food corresponds to 16 samples of 100 g of sliced cold-smoked salmon (Salmo salar), (CSS) that were purchased from local supermarkets and were processed from fresh never frozen fish. All the CSS samples had Aw values between 0.983 and 0.964, a pH about 6, and were preservative-free and vacuum-packaged. The reference bacteria used in this work are listed in Table 1.

Vizzini P., Beltrame E., Zanet V., Vidic J, & Manzano M. (2020). Development and Evaluation of qPCR Detection Method and Zn-MgO/Alginate Active Packaging for Controlling Listeria monocytogenes Contamination in Cold-Smoked Salmon. Foods, 9(10), 1353.

+ Open protocol

+ Expand

Quantitative PCR for CUL5 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For quantitative real-time polymerase chain reaction (qPCR), RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. Extracted RNA was first treated with DNase I enzyme (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s protocol to remove any contaminating traces of genomic DNA. Complementary DNA (cDNA) was then transcribed by RT-PCR using random primers and the Maxima First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s protocol. qPCR was then performed using specific primers to CUL5 (forward: 5’-GAACACAAGCACCCTCGTATT-3’, reverse: 5’-TCAACGGAGTTACATTCTCGTCT-3’; IDT, Leuven, Belgium) and actin (forward: 5’-CCAAGGCCAACCGCGAGAAGATGAC-3’, reverse: 5’-AGGGTACATGGTGGTGCCGCCAGAC-3’). CUL5 cDNA was amplified and measured using the SsoFast EvaGreen Kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s protocol. Cycling conditions were 95 °C (30 s, activation), 95 °C (5 s, denaturation) and 60 °C (10 s, annealing/extension) for 40 cycles for CUL5 amplification on a Bio-Rad CFX96 Real-Time System run on a C1000 Thermal Cycler platform (Bio-Rad, Hercules, CA, USA). Actin cDNA served as reference for relative quantification.

Tapia-Laliena M.Á., Korzeniewski N., Peña-Llopis S., Scholl C., Fröhling S., Hohenfellner M., Duensing A, & Duensing S. (2019). Cullin 5 is a novel candidate tumor suppressor in renal cell carcinoma involved in the maintenance of genome stability. Oncogenesis, 8(1), 4.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!