Rna stat 60 reagent

Total RNA was extracted using RNA STAT-60 Reagent (Tel-Test Inc., Friendswood, TX, USA) and reverse-transcribed using an iScript cDNA kit (Bio-Rad, Hercules, CA, USA). Real-time PCR was used to measure ALDH, NANOG, OCT4, SOX2, NIEL3, RAD2, RAD9A, RAD9B, RAD51, and RAD23A expression, and human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), or beta-actin (ACTB/β-actin) were used as references. The relative expression of target genes was calculated using the ΔΔCt method. Results are presented as the means ± SD of at least triplicate experiments. Primers are listed below (Table 1).

Total RNA of cells and rat tissue was extracted with the RNA-STAT-60 reagent (Tel-Test, Inc., Friendswood, TX, USA). RNA yield was determined using a Nanodrop 2000 spectrophotometer (Thermo Scientific). Total RNA (1 μg) was reverse transcribed into cDNA using the M-MLV reverse transcriptase system (Thermo Scientific). PCR primers were described previously [19 (link), 26 ], except human TIMP2 (Sense: AAGCGGTCAGTGAGAAGGAA; Anti-sense: GATGTTCAAAGGGCCTGAGA), rat MMP2 (Sense: GTAAAGTATGGGAACGCTGATGGC; Anti-sense: CTTCTCAAAGTTGTACGTGGTGGA), and rat TIMP2 (Sense: ACACGCTTAGCATCACCCAGAA; Anti-sense: CAGTCCATCCAGAGGCACTCAT). Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was carried out on the Mx3005P Multiplex Quantitative PCR System with MxPro QPCR software (Stratagene, La Jolla, CA, US). Brilliant SYBR Green QPCR Master Mix (Stratagene) was used to perform PCR. GAPDH was used as an endogenous reference against which the different template values were normalized. All PCR reactions were performed in duplicate. The cycle of threshold (Ct) method was used for quantification. Data were analyzed by MxPro QPCR software.

RNA from cells was extracted using RNeasy Plus Mini kit (74106, Qiagen) following manufacturers’ instructions. 30 μl of RNAse-free water was used for elution.
RNA from tissues was harvested by adding 1 ml of RNA Stat-60 reagent (Tel Test) to approximately 100 mg of frozen tissue placed in a Lysing Matrix D tube (MP Biomedicals). Samples were homogenised using a FastPrep homogeniser (MP Biomedicals) for 2 × 45 s at 5.5 m/s and centrifuged at 14,000 g for 5 min to pellet debris. The aqueous phase was transferred to a fresh tube containing 200 μl chloroform. Samples were mixed and centrifuged at 14,000 g, 4°C for 15 min. The clear upper phase containing RNA was removed and precipitated by mixing it with 500 μl isopropanol and incubating at room temperature for 10 min. Samples were centrifuged at 14,000 g, 4°C for 10 min and supernatants were discarded. RNA pellets were then washed with 70% ethanol, air-dried and re-suspended in 100 μl of RNAse-free water.
RNA concentration and purity were determined using Nanodrop ND-1000 spectrophotometer (Thermofisher Scientific). The absorbance was measured at 260 nm against RNAse-free water. A single A260 unit was assumed to be equal to 40 μg/mL of RNA. All RNA samples were stored at −80°C for subsequent processing.

RNA was extracted from tissue using RNA STAT60 reagent (Tel-Test, Inc.) according to the manufacturer’s instructions. Synthesis of cDNA was done using TaqMan reverse transcription reagents (Thermo Fisher Scientific) using 1 μg of RNA template per reaction, as per manufacturer’s instructions. Transcript expression was then analyzed by quantitative PCR (qPCR) in 10 μL duplicate reactions using qPCRBIO SyGreen Mix (part number PB20.11; PCR Biosystems, UK) and 1–4 μL of cDNA template. Reactions were loaded into 384-well qPCR plates (part number 72.1985.202; Sarstedt, UK) and run on a Light Cycler 480 (Roche). Transcript expression was calculated based on a cDNA titration loaded on each plate and was presented relative to expression of the housekeeping gene Ppia. Primers for Adipoq and Ppia were described and validated previously (3 (link)).

RNA was extracted in RNA STAT-60 reagent following the manufacturer’s instructions (Tel Test Inc). Reverse transcription was performed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems), and qPCR was performed on ViiA 7 Real-Time PCR System (Applied Biosystems) using PowerUp SYBR Green Master Mix (Applied Biosystems). All results were repeated in 3 biological replicates unless specified and relative gene expression changes were determined by ΔΔ Ct method (normalized to housekeeping gene, Rpl7). Primers are listed in Supplemental Table 2.