Cultured cells were washed in PBS (pH 7.4), fixed with 3.7% formaldehyde, and incubated overnight at 37°C in freshly prepared staining buffer [1 mg/ml X-gal (5-bromo-4-chloro-3-indolyl β-D-galactoside), 5 mM K3Fe [CN]6, 5 mM K4Fe [CN]6, and 2 mM MgCl2 in PBS (pH 6.0) or in citrate-buffered saline (pH 4.5)] [48 (link)]. At the end of the incubation, cells were washed with PBS, examined, and photographed using a Leica CTR 5000 microscope. β-Galactosidase staining was quantified using ImageJ software.
Ctr5000 microscope
Manufactured by Leica camera
Sourced in Germany
The CTR5000 is a high-performance microscope designed for laboratory and research applications. It features a robust and reliable construction, providing stable and precise imaging capabilities. The CTR5000 is equipped with advanced optics, enabling users to obtain clear and detailed observations of a wide range of samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (2 mentions)
In vitro transcription system, by Roche (1 mentions)
Sybr fast qpcr kit, by Roche (1 mentions)
Rna to cdna ecodry kit, by Takara Bio (1 mentions)
Rotor gene q thermocycler, by Qiagen (1 mentions)
Ab26350, by Abcam (1 mentions)
Ab16667, by Santa Cruz Biotechnology (1 mentions)
Biotinylated goat anti rabbit igg, by Vector Laboratories (1 mentions)
Serum free blocking solution, by Agilent Technologies (1 mentions)
Biotinylated goat anti mouse igg, by Abcam (1 mentions)
4 protocols using ctr5000 microscope
1
X-Gal Staining for β-Galactosidase Activity
2
Zebrafish Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Digoxigenin-labeled probes were synthesized using an in vitro transcription system (Roche). Whole-mount in situ hybridization was performed as described [26 (link)]. Images were captured with a Leica CTR5000 microscope (Wetzlar, Germany). For gene expression analyses, whole body homogenates of embryos at 5.3 days post fertilization (dpf) and homogenates of livers dissected from 8 month old male adult zebrafish were used. Total RNA was extracted with Trizol (Thermo Fisher, Cat#15596026) following the manufacturer’s protocol. cDNA was prepared with an RNA to cDNA EcoDry kit (Takara-Clontech, Cat#639543) and qPCR was performed with a SYBR fast qPCR kit (Kapa, Cat#KK4602), using a Rotor Gene Q thermocycler (Qiagen). The qPCR primers used in these studies were: beta-actin (GenBank, NM_131031), 5’GGCTTCTGCTCTGTATGG3’ and 5’AACGCTTCTGGAATGACTAA3’ ; lcat (GenBank, XM_001332792), 5’CGGTTACTTCCACACTATG3’ and 5’TACTCCTCCTGCTCATTC3’ ; cetp (GenBank, XM_009293552), 5’CCATAATGACGGACGATT3’ and 5’ATGACTCTGACTGATGTG3’ ; apoa1 (GenBank, NM_131128), 5’GCACTGACTCTTCTCTTG3’ and 5’CTGATCCTTGACCTGGTT3’ ; apoe (GenBank, NM_131098), 5’CCTCTGATGCTGCTGGTC3’ and 5’CTGAGTGCTGCGTTCCTT3’ ; apoB (GenBank, XM_689735), 5’AGAGGCTTAGAGATATGCTGAGT3’ and 5’GGCGTGGATGTTGCTTGA3’ ; and mtp (GenBank, NM_212970), 5’GATAACGGCAAACTCTACA3’ and 5’GCTAATCCTGAATCCAACA3’ .
3
Flower Anatomy Analysis via Microscopy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On the day of flowering, individual flowers were cut from the inflorescence using a scalpel to observe the structures of the stamen, anther, and pistil under a stereomicroscope. Buds (approximately 3 mm long) from the BoMS1 gene mutant and the wild type were fixed overnight in 50% ethanol, 5% acetic acid, and 3.7% formaldehyde in water, dehydrated through an ethanol series (30%, 50%, 70%, 80%, 90%, 100%), and embedded into paraffin blocks50 (link). Cross-sections were cut, approximately 2–3-μm-thick, stained in hematoxylin, and photographed using a Leica CTR5000 microscope.
4
Immunohistochemical Analysis of Protein Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue was fixed in buffered 10% formalin overnight; transferred to 70% ethanol and then sectioned, processed and embedded in paraffin. Target antigen retrieval solution at pH 6 (Dako, Carpinteria, CA, USA) was used for antigen retrieval and all slides were treated with 3% H2O2 in methanol to block endogenous peroxidases. General protein blocking was performed with serum-free blocking solution (Dako, Carpenteria, CA, USA). The slides were stained with antibodies against Ki-67 (Abcam, ab16667), ERα (Santa Cruz, 2Q418) or γ-H2A.X (phospho S139, Abcam, ab26350). The secondary antibodies used were biotinylated goat anti-rabbit IgG (Vector Laboratories, Burlingame, CA, USA; BA-100) for Ki-67, biotinylated goat anti-mouse IgG (Abcam, Cambridge, MA, USA; ab64255) for ERα and γ-H2A.X. All slides were counterstained with hematoxylin and imaged on a Leica CTR5000 microscope (Wetzlar, Germany). Quantification was done on triplicate photomicrographs (depicted as panels in images) by counting positively stained cells by a blinded investigator. Images that are representative of organs from 3 animals are shown in figures. Blinded, non-quantitative histological evaluation of mammary tumors was performed by a pathologist [G.K.M.]
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!