Log In Sign up
The largest database of trusted experimental protocols

Rneasy plus mini rna extraction kit

Manufactured by Qiagen
Visit Supplier
Sourced in United States

The RNeasy Plus Mini RNA extraction kit is a product designed for the purification of high-quality total RNA from small amounts of various sample types, including animal and plant tissues, cells, and bacteria. It employs a silica-membrane-based technology to efficiently capture and purify RNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

Taqman gene expression assay, by Thermo Fisher Scientific (11 mentions) Gentamicin, by Thermo Fisher Scientific (5 mentions) Real time pcr master mix, by Thermo Fisher Scientific (5 mentions) Amphotericin b, by Thermo Fisher Scientific (4 mentions) Hiseq 2500, by Illumina (4 mentions) Cell culture dishes, by BD (3 mentions) Centrifuge tube, by BD (3 mentions) Ready to go primer first strand beads, by GE Healthcare (3 mentions) Ready to go you prime first strand beads, by GE Healthcare (3 mentions) L carnitine, by Merck Group (2 mentions) Betaine, by Merck Group (2 mentions) Erythritol, by Merck Group (2 mentions) Ham f12, by Thermo Fisher Scientific (2 mentions) Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (2 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions) Epidermal growth factor (egf), by Thermo Fisher Scientific (2 mentions) Trypan blue, by Thermo Fisher Scientific (2 mentions) Tunel apoptosis detection kit, by Roche (2 mentions) 4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (2 mentions) Percoll, by Thermo Fisher Scientific (2 mentions)

Spelling variants of this product

RNeasy Mini Kit (41418 citations) RNeasy Plus Mini Kit (7097 citations) RNeasy Plus kit (1019 citations) RNA extraction kit (593 citations) RNeasy extraction kit (334 citations) RNeasy Mini (299 citations) RNA mini kit (163 citations) RNeasy Plus Mini (68 citations) RNA Plus Mini Kit (21 citations) RNeasy kit Mini Kit (2 citations)

19 protocols using rneasy plus mini rna extraction kit

1

Oxidative Stress Biomarkers Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell culture dishes, plates, centrifuge tubes, and other plastic ware were purchased from BD Biosciences (Lincoln Park, NJ); Dulbecco modified Eagle medium (DMEM), Ham F-12, amphotericin B, and gentamicin were from Invitrogen (Grand Island, NY). Fetal bovine serum (FBS) was from Hyclone (Logan, UT). RNeasy Plus Mini RNA extraction kit from Qiagen (Valencia, CA); Ready-To-Go-Primer First-Strand Beads were from GE Healthcare (Piscataway, NJ); TaqMan gene expression assays and real-time PCR master mix were from Applied Biosystems (Foster City, CA). DCFDA—Cellular Reactive Oxygen Species Detection Assay Kit, rabbit polyclonal antibody against human malondialdehyde (MDA), 8-hydroxy-2-deoxyguanosine (8-OHdG), 4-hydroxy-2-nonenal (HNE), aconitase-2, glutathione peroxidase-1 (GPX1), and mouse monoclonal antibody against superoxide dismutase-1 (SOD1) were purchased from Abcam (Cambridge, MA). Rabbit polyclonal antibody against human heme oxygenase-1 (HMOX1) and cyclooxygenase-2 (COX2) were from Santa Cruz Biotechnology (Santa Cruz, CA). β-actin antibody was from BioLegend (San Diego, CA). Fluorescein Alexa-Flour 488-conjugated secondary antibodies (donkey anti-rabbit, or goat anti-mouse IgG) were from Molecular Probes (Eugene, OR).
Deng R., Hua X., Li J., Chi W., Zhang Z., Lu F., Zhang L., Pflugfelder S.C, & Li D.Q. (2015). Oxidative Stress Markers Induced by Hyperosmolarity in Primary Human Corneal Epithelial Cells. PLoS ONE, 10(5), e0126561.
+ Open protocol
+ Expand
2

Evaluating Pluripotency Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
IMR90-1 cells (80% confluence) were grown in 35 mm dish and treated with either 125 uM of SA, 250 uM of H2O2, or HS (42°C). Cells were washed three times with PBS, dissociated using ReLeSR, and then total cell RNA was extracted from treated or non-treated cells using RNeasy plus Mini RNA extraction Kit (QIAGEN) according to the manufacturer's protocol. cDNA was synthesized using the Superscript III first-strand cDNA synthesis kit (Invitrogen) according the manufacturer protocol and then used as a template for PCR reaction to qualitatively examine the gene expression of pluripotency genes. GAPDH was used as loading control. Sequences of the forward (F) and the reverse (R) primers to amplify each gene are listed in Table 1.
Palangi F., Samuel S.M., Thompson I.R., Triggle C.R, & Emara M.M. (2017). Effects of oxidative and thermal stresses on stress granule formation in human induced pluripotent stem cells. PLoS ONE, 12(7), e0182059.
+ Open protocol
+ Expand
3

Inflammatory Cytokine Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell culture dishes, plates, centrifuge tubes, and other plastic ware were purchased from BD Biosciences (Lincoln Park, NJ); Dulbecco modified Eagle medium (DMEM), Ham F-12, amphotericin B, and gentamicin were from Invitrogen (Grand Island, NY). Fetal bovine serum (FBS) was from Hyclone (Logan, UT). L-carnitine, erythritol, betaine and capsazepine were from Sigma-Aldrich (St. Louis, MO). Human TNF-α, IL-1β, IL-6 and IL-8 ELISA kits were from Biolegend (San Diego, CA). RNeasy Plus Mini RNA extraction kit from Qiagen (Valencia, CA); Ready-To-Go-Primer First-Strand Beads were from GE Healthcare (Piscataway, NJ); TaqMan gene expression assays and real-time PCR master mix were from Applied Biosystems (Foster City, CA).
Hua X., Su Z., Deng R., Lin J., Li D.Q, & Pflugfelder S.C. (2014). Effects of L-carnitine, Erythritol and Betaine on Pro-inflammatory Markers in Primary Human Corneal Epithelial Cells Exposed to Hyperosmotic Stress. Current eye research, 40(7), 657-667.
+ Open protocol
+ Expand
4

Hippocampal BDNF Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was prepared from hippocampi using the Rneasy Plus Mini RNA extraction kit (Qiagen) and reverse transcription was performed using QuantiTect reverse transcription kit (Qiagen) according to the manufacturer's protocol. Real-time PCR was performed using a standard PCR protocol, with Sybr green dye (BioRad).
The primer sequences used are BdnfI: (CAGGACAGCAAAGCCACAAT and GCCTTCATGCAACCGAAGTA) and Gapdh: (CTCTCTGCTCCTCCCTGTTC and CCGACCTTCACCATTTTGTC).
Nasrallah P., Haidar E.A., Stephan J.S., El Hayek L., Karnib N., Khalifeh M., Barmo N., Jabre V., Houbeika R., Ghanem A., Nasser J., Zeeni N., Bassil M, & Sleiman S.F. (2019). Branched-chain amino acids mediate resilience to chronic social defeat stress by activating BDNF/TRKB signaling. Neurobiology of Stress, 11, 100170.
+ Open protocol
+ Expand
5

Investigating Epithelial Cell Barrier Function

Check if the same lab product or an alternative is used in the 5 most similar protocols
The culture supplies such as Dulbecco modified Eagle medium (DMEM), Ham-F12, Cortisone, EGF, gentamicin, and amphotericin B, TaqMan gene expression assays and real-time PCR master mix, the rabbit polyclonal antibodies against human zonula occludens (ZO)-1, occludin, claudin-1 and E-cadherin, as well as IL-37 Human ELISA Kit, were purchased from Thermo Fisher Scientific (Waltham, MA). Fetal bovine serum (FBS) was from Hyclone (Logan, UT). RNeasy Plus Mini RNA extraction kit from Qiagen (Valencia, CA). Ready-To-Go You-Prime First-Strand Beads were from GE Healthcare (Piscataway, NJ). Fluorescein Alexa-Fluor 488-conjugated secondary antibodies (goat anti rabbit IgG) were from Molecular Probes (Eugene, OR). Recombinant human (rh) IL-37 and TNF-α were from ProSpec (East Brunswick NJ). ELISA kit for human TNF-α was from BioLegend (San Diego, CA), and Cathepsin S from Boster Bio (Pleasanton, CA). All plastic ware was purchased from Becton Dickinson Biosciences (Lincoln Park, NJ).
Zhang Y., Li J.M., Lu R., Liu Z., Chen X., de Paiva C.S., Pflugfelder S.C, & Li D.Q. (2022). Imbalanced IL-37/TNF-α/CTSS signaling disrupts corneal epithelial barrier in a dry eye model in vitro. The ocular surface, 26, 234-243.
+ Open protocol
+ Expand
6

Proteomic analysis of protein complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies to the indicated proteins were purchased from the following vendors: BRD4 (ab128874), BRD2 (ab139690), PSMD14 (ab109123) and PSMD1 (ab140682; all Abcam); BRD3 (A302-368A; Bethyl); tubulin (926-42211; LICOR Biosciences); PSMD4 (3846), PSMD2 (25430), biotin (5597) and H2B (12364; Cell Signaling Technology) and PSMA1 (BML-PW8100-0100; ENZO Life Sciences). IRDye-800 anti-rabbit (926-32211) and IRDye-680RD anti-mouse (926-68072) secondary antibodies were purchased from LICOR Biosciences. Bortezomib (179324-69-7) was purchased from Calbiochem. Streptavidin magnetic beads (88816), NeutrAvidin agarose beads (29200), Lipofectamine RNAiMAX transfection reagent (13778075), RNA-to-Ct 1-Step kit (4392653) and TaqMan gene expression assays were purchased from Thermo Fisher. An RNeasy Plus mini RNA extraction kit (74134) was purchased from Qiagen.
Bashore C., Prakash S., Johnson M.C., Conrad R.J., Kekessie I.A., Scales S.J., Ishisoko N., Kleinheinz T., Liu P.S., Popovych N., Wecksler A.T., Zhou L., Tam C., Zilberleyb I., Srinivasan R., Blake R.A., Song A., Staben S.T., Zhang Y., Arnott D., Fairbrother W.J., Foster S.A., Wertz I.E., Ciferri C, & Dueber E.C. (2022). Targeted degradation via direct 26S proteasome recruitment. Nature Chemical Biology, 19(1), 55-63.
+ Open protocol
+ Expand
7

Molecular Profiling of Epithelial Barrier

Check if the same lab product or an alternative is used in the 5 most similar protocols
The culture supplies such as Dulbecco modified Eagle medium (DMEM), Ham-F12, Cortisone, EGF, gentamicin, and amphotericin B, TaqMan gene expression assays and real-time PCR master mix, as well as the rabbit polyclonal antibodies against ZO-1 and occludin were obtained from Thermo Fisher Scientific (Waltham, MA). Fetal bovine serum (FBS) from Hyclone (Logan, UT). RNeasy Plus Mini RNA extraction kit from Qiagen (Valencia, CA). Ready-To-Go You-Prime First-Strand Beads were from GE Healthcare (Piscataway, NJ). Fluorescein Alexa-Flour 488-conjugated secondary antibodies (goat anti rabbit IgG) were from Molecular Probes (Eugene, OR). Recombinant human (rh) IL-36α, IL-36RA, IL-38 and IL-1RA were from ProSpec (East Brunswick NJ). IL-36α ELISA kit was from R & D Systems (Minneapolis, MN) and ELISA kits for TNF-α and IL-1β were from BioLegend (San Diego, CA). All plastic ware was purchased from Becton Dickinson Biosciences (Lincoln Park, NJ).
Li J.M., Lu R., Zhang Y., Lin J., Hua X., Pflugfelder S.C, & Li D.Q. (2021). IL-36α/IL-36RA/IL-38 signaling mediates inflammation and barrier disruption in human corneal epithelial cells under hyperosmotic stress. The ocular surface, 22, 163-171.
+ Open protocol
+ Expand
8

Pterostilbene Modulates Oxidative Stress Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pterostilbene was purchased from Sigma-Aldrich (St. Louis, MO). Cell culture supplies such as Dulbecco modified Eagle medium (DMEM), Ham-F12, Cortisone, EGF, gentamicin, amphotericin B were obtained from Invitrogen (Grand Island, NY); Fetal bovine serum (FBS) from Hyclone (Logan, UT). DCFDA-cellular ROS detection assay and rabbit polyclonal antibodies against MDA, 4-HNE, aconitase-2 or 8-OHdG were from Abcam (Cambridge, MA). Fluorescein Alexa-Flour 488-conjugated secondary antibodies (goat anti rabbit or mouse IgG, rabbit or donkey anti goat IgG) were from Molecular Probes (Eugene, OR). RNeasy Plus Mini RNA extraction kit from Qiagen (Valencia, CA). TaqMan gene expression assays and real-time PCR master mix from Applied Biosystems (Foster City, CA). Ready-To-Go You-Prime First-Strand Beads were from GE Healthcare (Piscataway, NJ). ELISA kits for TNF-α, IL-1 β and IL-6 were from Biolegend (San Diego, CA). Gelatin zymogram gels were from Bio Rad (Hercules, CA). All plastic ware were purchased from Becton Dickinson Biosciences (Lincoln Park, NJ).
Li J., Ruzhi D.e.n.g., Hua X., Zhang L., Lu F., Coursey T.G., Pflugfelder S.C, & Li D.Q. (2016). Blueberry Component Pterostilbene Protects Corneal Epithelial Cells from Inflammation via Anti-oxidative Pathway. Scientific Reports, 6, 19408.
+ Open protocol
+ Expand
9

Quantification of MMP Expression and Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell culture dishes, plates, centrifuge tubes, and other plastic ware were purchased from BD Biosciences (Lincoln Park, NJ). Dulbecco modified Eagle medium (DMEM), Ham F-12, amphotericin B, and gentamicin were from Invitrogen (Grand Island, NY). Fetal bovine serum (FBS) was from Hyclone (Logan, UT). L-carnitine, erythritol, and betaine were from Sigma-Aldrich (St. Louis, MO). The RNeasy Plus Mini RNA extraction kit from Qiagen (Valencia, CA). The Ready-To-Go-Primer First-Strand Beads were from GE Healthcare (Piscataway, NJ). The TaqMan gene expression assays and real-time PCR master mix were from Applied Biosystems (Foster City, CA). The MMP antibodies were from Sigma-Aldrich (St. Louis, MO). The ready zymogram gels were from Bio-Rad (Hercules, CA).
Deng R., Su Z., Hua X., Zhang Z., Li D.Q, & Pflugfelder S.C. (2014). Osmoprotectants suppress the production and activity of matrix metalloproteinases induced by hyperosmolarity in primary human corneal epithelial cells. Molecular Vision, 20, 1243-1252.
+ Open protocol
+ Expand
10

Isolation and Culture of Rat Leydig Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
LPS was from Sigma (E.coli serotype O127:B8, St. Louis, MO, USA). DMEM-F12, collagenase type IV, Percoll, trypan blue, BSA, FBS, DAPI and penicillin/streptomycin were from Gibco (Grand Island, NY, USA).
CCK-8 assay kits were obtained from Dojindo(Kyushu, Japan). RIA kits for testosterone were purchased from Diagnostic Systems Laboratories (Webster, TX, USA). TUNEL apoptosis detection kits were obtained from Roche Diagnostics (East Sussex, UK). The BCA protein assay kits and Trizol reagent were obtained from Thermo Fisher Scienti c (Waltham, MA, USA). DNeasy tissue extraction kits and RNeasy Plus Mini RNA extraction kits were from Qiagen (Valencia, CA, USA). TaqMan gene expression assays and RT-PCR master mix were from Applied Biosystems (Foster City, CA, USA). Rabbit polyclonal antibody to ADM (Cat. All other chemicals used in this study were of the highest commercial grade and purchased from Sigma (St. Louis, MO, USA).
Luo Y.W., Zhu X.L., Li M.Y., Zhou J.H., Yang Z.M., Tong T., Chen B.H., Qin S.L., Liu B.L, & Hu W. (2023). Anti-apoptotic effect of adrenomedullin gene delivery on Leydig cells by suppressing TGF-β1 via the Hippo signaling pathway. Reproductive toxicology (Elmsford, N.Y.), 119.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!