Control and target plasmids were cloned using the
BLOCK-iT™ U6 RNAi Entry Vector Kit (ThermoFisher™ Scientific, Waltham, Massachusetts, USA), according to the manufacturer´s recommendations. Short hairpin RNA oligos were designed using the Invitrogen Block-iT™ RNAi designer tool. Oligos were designed to target FAM83H-AS1 Exon 1 sequence (Oligo sh Top sequence: CACCGAAGAACATCCCAGATTACCCGCGAACGGGTAATCTGGGATGTTCTTTT; Bottom sequence: AAAAGAACATCCCAGATTACCCGTTCGCGGGTAATCTGGGATGTTCTTC). This double stranded oligo was then annealed and cloned into the entry vector
pENTR™/U6 (ThermoFisher™ Scientific, Waltham, Massachusetts, USA). The plasmids were then introduced onto
E. coli TOP10 competent cells, which were grown in LB/agar medium at 37 °C.
Plasmids were purified using
GeneJet Plasmid Miniprep Kit (ThermoFisher™ Scientific, Waltham, Massachusetts, USA) and sequenced to confirm insert integrity.
Transfection experiments were performed using
Xfect™ Transfection Reagent (Clontech Laboratories Inc., Mountain View, California, USA) following the manufacturer´s instructions. Briefly, 100,000 cells were cultured 24 h prior to transfection in 24-well plates. 750 ng of the random plasmid and 750 ng of sh-FAM83H-AS1 plasmid were diluted and then added to each well. Transfection reaction was incubated for 24 h; medium was removed and replaced with fresh complete medium.
Ríos-Romero M., Cedro-Tanda A., Peña-Luna M., Mancera-Rodríguez M.A., Hidalgo-Pérez L., Cisneros-Villanueva M., Beltrán-Anaya F.O., Arellano-Llamas R., Jiménez-Morales S., Alfaro-Ruíz L.A., Tenorio-Torres A., Domínguez-Reyes C., Villegas-Carlos F., Ochoa-Mendoza E, & Hidalgo-Miranda A. (2020). FAM83H-AS1 is a potential modulator of cancer driver genes across different tumors and a prognostic marker for ER/PR + BRCA patients. Scientific Reports, 10, 14145.