Phanta hs super fidelity dna polymerase

DNA was extracted from peach leaves using a DNeasy Plant Mini Kit (Tiangen, Beijing, China). From this extracted DNA, the promoter regions of PpNCED genes were amplified by PCR using Phanta HS Super-Fidelity DNA Polymerase (Vazyme, Nanjing, China), cloned into the pTOPO-blunt vector (Aidlab, Beijing, China) and sequenced. DNA sequence alignments of the cloned promoters were performed using MEGA 5.0 software. The motifs or cis-elements in the promoter sequences were identified using the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/)^{34 (link)}.

4′,6‐diamidine‐2′‐phenylindole dihydrochloride (DAPI) and L‐threonine standard were purchased from Sigma‐Aldrich (St. Louis, MO, USA). Glucose, glycerol, hydrochloric acid, hydrogen peroxide (30% aqueous solution), and acetic acid were purchased from Sinopharm Chemical Reagent Beijing Co. Ltd. (Shanghai, China). Phanta HS Super‐Fidelity DNA Polymerase was purchased from Vazyme Biotech (Nanjing, China). High‐performance liquid chromatography (HPLC)‐grade acetonitrile (75‐05‐8) was obtained from Tedia (ACN, Tedia Company, Inc., Fairfield, OH, USA). Triethylamine (CAS, 121‐44‐8) and phenyl isothiocyanate (CAS, 103‐72‐0) were purchased from Aladdine. Chloramphenicol was purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Size Separation Master Kit was purchased from ProteinSimple (San Jose, CA). HRP Goat Anti‐Mouse IgG (H+L) (Catalog NO: AS003) was purchased from ABclonal Technology Co.,Ltd.

The CDS sequence of human SUVS9H1 was amplified by Phanta HS Super-Fidelity DNA Polymerase (Vazyme Biotech Co., Nanjing, China), and inserted into the pcDNA3.1+ vector by NheI/BamHI (New England Biolabs Inc., Ipswich, MA, USA) digestion. The sequenced positive plasmids were transfected into ATDC5 cells by lipofectamine 3000 (Invitrogen, Carlsbad, USA) following the user guide. The CDS amplifying primers were listed in Table 6.Table 6

Primers sequences for construction of human SUV39H1- pcDNA3.1(+)

Primers sequence (5′–3′)	CDS length (bp)
F: CGGCTAGCATGGCGGAAAATTTAAAAG	1239
R: CGGGATCCCTAGAAGAGGTATTTGCGG

Abbreviation: F forward, R reverse, CDS coding sequence

To clone the coding sequence (CDS) of PpePL members, the cDNAs from fruit of cv. “ZFW” were used as templates for PCR amplification. Specific primers were designed based on published genome sequences by Primer Premier 6.0 software. Primer sequences are listed in Supplementary Table S1. The full-length CDS of PpePL genes was amplified using Phanta HS Super-Fidelity DNA Polymerase (Vazyme, Nanjing, China). The PCR products were inserted into the pMD18-T vector (TaKaRa, Dalian, China) and transferred into competent Escherichia coli cells (Tiangen Biotech, Beijing, China). Then, the positive clones were sequenced with M13-F and M13-R. The cloned sequences were listed in Supplementary Figure S1.

All bacterial strains, plasmids, and primers used in this work were summarized in Tables 1–3. E. coli DH5α and BW25141 were used as the hosts for molecular cloning and manipulation of plasmids. To construct the integrative plasmid, pKTAL, two DNA fragments, R6K-FRT-kan and tac-hemA^M-hemL were amplified using RFK-F/RFK-R and HemAL-F/HemAL-R as the primers and plasmids, pG-2 and pDAL as the templates, respectively. The Phanta HS super-fidelity DNA polymerase was purchased from Vazyme Biotech (Nanjing, China). The two DNA fragments were then assembled in vitro using Gibson assembly and transferred into E. coli strain BW25141 for further replication and verification.
Plasmid pdCas9 was gifted from Luciano Marraffini (Addgene plasmid # 4656), which introduced D10A and H840A mutations in Cas9 for abolishing the cleavage activity. The new spacer sequences were inserted into pdCas9 via the Golden Gate assembly as previously reported. Briefly, pdCas9 was digested with BsaI and then ligated with the annealed complementary oligonucleotides containing corresponding sticky ends. Complementary oligonucleotides used in the study are listed in Table 4.