We picked the experimental materials from Nujiang Lisu Autonomous Prefecture, Yunnan Province. Inflorescences of L. yunnanensis were collected, bottled, and brought back to Kunming for subsequent use. The blooming flowers of five individuals collected within LLO (Table 6 ) were frozen immediately in liquid nitrogen and stored at −80 °C for use as transcriptome sequencing materials. The plant samples were mixed, and RNA was extracted using an RNA extraction kit from TransGen (Beijing, China). Transcriptomic sequencing was performed at Beijing Novogene Biological Information Technology Co., Ltd., Beijing, China. Based on the results of previous investigations into the resource status of L. yunnanensis, 6 populations were selected as primer polymorphism detection materials in regions with a dense distribution and adequate quantity, and where sampling was convenient and relatively representative. These were GDX, GCG, FMM, FPK, LLO, and LCM (Table 6 ).
Rna extraction kit
Manufactured by Transgene
Sourced in China
The RNA extraction kit is a laboratory tool designed to purify and isolate high-quality RNA from a variety of biological samples. It utilizes a simple and efficient method to extract RNA, which can then be used for various downstream applications such as gene expression analysis, RT-PCR, and RNA-sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Reverse transcription kit, by Transgene (2 mentions)
One step gdna removal and cdna synthesis supermix, by Transgene (1 mentions)
Cdna synthesis kit, by Takara Bio (1 mentions)
Sybr green master mix, by Bio-Rad (1 mentions)
Perfectstart green qpcr supermix, by Transgene (1 mentions)
Sybr green real time pcr master mix, by Transgene (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Transscript mirna first strand cdna synthesis kit, by Transgene (1 mentions)
Transstart top green qpcr supermix, by Transgene (1 mentions)
Simpliamp, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Iq5 real time pcr detection system, by Bio-Rad (1 mentions)
One step cloning kit, by Novoprotein (1 mentions)
Cdna synthesis kit, by Novoprotein (1 mentions)
Restriction enzyme, by New England Biolabs (1 mentions)
First strand cdna synthesis supermix kit, by Transgene (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Complementary dna synthesis kit, by Transgene (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
34 protocols using rna extraction kit
1
Transcriptome Sequencing of Litsea yunnanensis
2
Maize Genomic DNA and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from transgenic maize leaves using cetrimonium bromide. Total RNA was extracted from 20‐DAP seeds using an RNA extraction kit from TransGen Biotech (Beijing, China). One‐step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech) was used to synthesize first‐strand cDNA. The quality of cDNA was determined with primers targeting the maize ZmActin1 gene, which was also used as the internal normalization factor in maize. Primers used for quantitative RT‐PCR and PCR are listed in Tables S3 and S4 .
3
Evaluating Apoptosis-Related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF-7, and MDA-MB-231 cells were treated with L3B, L, L3, and L + L3 at IC50 concentrations for 72 h. The RNA extraction kit (Transgene Biotech) was used for isolation of RNA content of the treated cells. The cDNAs were obtained using the cDNA synthesis kit (Takara, Japan). The expression rate of BCL2, Bax, and p53 were assessed using real-time PCR. The beta actin (ß-actin) expression level was used as an internal control. The real-time PCR primers are listed in Table 2 . The real-time PCR program was as follows: 95°C 10 min, 95°C 15 s (35 cycles), and 72° C 1 min. The total volume of the amplification reaction was 20 µL using SYBR® Green Master Mix (Bio-Rad, USA) and the products were run on 2% agarose gel. Data were evaluated by the icycler iQ real-time detection system, and the fold changes were calculated based on the threshold cycle (Ct) value.
Primers and Their Sequences Used in the Real Time PCR38 (link)
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Bax | 5’-CGGCAACTTCAACTGGGG-3’ | 5’-TCCAGCCCAACAGCCG-3’ |
| Bcl2 | 5-’GGTGCCGGTTCAGGTACTCA-3’ | 5’-TTGTGGCCTTCTTTGAGTTCG-3’ |
| p53 | 5’-CATCTACAAGCAGTCACAGCACAT-3’ | 5’-CAACCTCAGGCGGCTCATAG-3’ |
| ß-actin | 5-’TCCTCCTGAGCGCAAGTAC −3’ | 5’CCTGCTTGCTGATCCACATCT-3’ |
4
RNA Extraction and RT-qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from cells. The operation steps were referred to the instructions of RNA extraction kit (Transgen, Beijing, China). Nanodrop spectrophotometer was used to detect the concentration and purity of total RNA (the ratio of A260/A280 was between 1.8 and 2.0). The reverse transcription kit (Transgen) was used for reverse transcription. The product of the cDNA was stored at −20°C. The reaction conditions were as follows: pre-denaturation: 95°C 30 seconds; PCR cycle: 95°C denaturation 15 seconds; 60°C annealing 20 seconds; 70°C extension 20 seconds for 40 cycles; melting curve analysis: 95°C 5 seconds, 60°C 30 seconds. The relative expression of RNA was expressed by 2−ΔΔct method. After 3 independent repetitive experiments, each sample was analyzed statistically.
5
Temporal Expression of P3A-ATPase in Cotton
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR primers were designed according to the sequences of P3A-ATPase genes (Table S3 ). The RNA of brown cotton fibers at 6 days post-anthesis (DPA), 12 DPA, 18 DPA, 24 DPA and 30 DPA was extracted with an RNA extraction kit (TransGen Biotech, Beijing, China) and used to perform qRT-PCR. The total volume was 20 μL, including 10 μL of SYBR®Premix Ex Taq ™ II (2x), 2 μL of cDNA, and 0.8 μL of upstream and downstream primers. The reaction procedure was as follows: 50 °C for 2 min, 95 °C for 30 s, 40 cycles of 95 °C for 15s, 60 °C for 20 s and 68 °C for 20 s, and 4 °C for storage. The UBQ7 gene was used as an internal reference gene [46 (link)]. For each experiment, three biological replicates were executed, and the relative expression levels were calculated using the 2−△△Ct method [47 (link)].
6
SARS-CoV-2 Inhibition Assay with S-20-1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The inhibitory activity of S-20-1 against authentic viruses was tested according to previous study45 (link). In brief, S-20-1 was serially diluted with DMEM without FBS. Then 100 TCID50 of virus were mixed with diluted S-20-1 . After incubation for 30 min, the mixtures were transferred to target cells (RD for HCoV-OC43, Huh-7 for HCoV-229E, and Caco-2 for SARS-CoV-2 and SARS-CoV-2 Delta). The medium was changed 12 h later, and cell viability was detected with CCK8 kit (HCoV-OC43 and HCoV-229E). For SARS-CoV-2 and SARS-CoV-2 Delta, the supernatants were collected after 48 h. The viral RNA load was tested as previously reported45 (link). Briefly, the viral RNA was extracted with RNA extraction kit (Transgene, China). Then the N gene of SARS-CoV-2 was tested by real-time RT-PCR. The sequence of primer and probe follows:
Forward: GGGGAACTTCTCCTGCTAGAAT;
Reverse: CAGACATTTTGCTCTCAAGCTG
Probe: 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′
Forward: GGGGAACTTCTCCTGCTAGAAT;
Reverse: CAGACATTTTGCTCTCAAGCTG
Probe: 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′
7
Colon RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After grinding, colon RNA was extracted by an RNA extraction kit (TransGen Biotech, China). Reverse transcription and real-time PCR were performed by PerfectStart Green qPCR Super Mix (TransGen Biotech, China) and conducted three times. The primer sequences are shown in Table 1 .
8
Colon Inflammation Biomarker Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tissue samples of distal colon were collected from the inferior vena cava. After centrifugation, the sample was collected for the detection of inflammatory factors as previous report [9 (link)]. Total RNA was extracted according to RNA extraction kit (ER501-01, TransGen Biotech, China). Real-time quantitative PCR (RT-qPCR) was carried out according to SYBR Green Real-Time PCR MasterMix (AQ602-14, TransGen Biotech, China). The expression level of β-actin was used as reference. All primer sequences used in this study are given in Table 1 .
9
Investigating Anti-Inflammatory Effects of 18β-Glycyrrhetinic Acid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were treated with 18β-GA (0, 5, 10, and 20 µM) and DEX (1 µM) followed by TNF-α(20 h). Then, the cells were washed with PBS and total ribonucleic acid (RNA) was extracted using an RNA extraction kit (TransGen Biotech, Beijing, China). Real-time PCR was performed in triplicate with the CFX96 Touch™ Real-time PCR detection system (Bio-Rad Laboratories). All primers were synthesized by TSINGKE(Wuhan, China). The sequences of all primers are listed in Table 1 .
Sequences of primers for real-time quantitative.
| Gene | Forword primer(5′ → 3′) | Reverse primer(5′ → 3′) |
|---|---|---|
| GAPDH | CAGGAGGCATTGCTGATGAT | GAAGGCTGGGGCTCATTT |
| IL-4 | ATGGGTCTCACCTCCCAACT | TATCGCACTTGTGTCCGTGG |
| IL-5 | CAGGGAATAGGCACACTGGA | TCTCCGTCTTTCTCCACAC |
| IL-13 | TGGTATGGAGCATCAACCTGAC | GCATCCTCTGGGTCTCG |
10
Quantifying miR-21-5p Expression in Liver Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of Hep3B and Huh-7 cells was extracted by RNA extraction Kit (TransGen Biotech, Beijing, China). TransScript miRNA First-Strand cDNA Synthesis Kit (TransGen Biotech) was utilized for the synthesis of qRT-PCR templates. TransStart Top Green qPCR SuperMix (TransGen) was used to perform qRT-PCR. The primers for miR-21-5p and internal control were purchased from Sangon Biotech (Sangon, Shanghai, China). All data were calculated by 2−ΔΔCt method. The sequences of primers for miR-21-5p and U6 small RNA were listed as follows: U6: Forward: 5ʹ-GCGCGTCGTGAAGCGTTC-3ʹ, Reverse: 5ʹ-GTGCAGGGTCCGAGGT-3ʹ; miR-21-5p: Forward: 5ʹ-TGCGCTAGCTTATCAGACTGAT-3ʹ, Reverse: 5ʹ-CCAGTGCAGGGTCCGAGGTATT-3ʹ.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!