Inducible pLKO-Tet-On vector was cloned with shRNA fragments specifically aiming at AURKA [26 (link)]. Then cloning of human genome cDNA for RBM4 fragments in full length and truncated length as well as pLVX-DsRed-Monomer-N1 vector (Clontech) ligation was implemented, and Flag was labeled. DNA sequencing was performed to examine all vectors for the fidelity. As instructed by the manufacturer, the cell transfection with expression plasmids was executed via lipofectamine 2000 or lipofectamine 3000 (Invitrogen). Supplementary Tab. 3 displayed all primers in the present research.
Plvx dsred monomer n1 vector
Manufactured by Takara Bio
Sourced in United States
The PLVX-DsRed-Monomer-N1 vector is a lentiviral expression vector that allows for the expression of a DsRed-Monomer fluorescent protein in mammalian cells. The DsRed-Monomer protein is a monomeric variant of the DsRed protein, which emits red fluorescence when expressed in cells. The vector includes the necessary elements for lentiviral packaging and integration into the host cell genome.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax, by Thermo Fisher Scientific (3 mentions)
Puromycin, by Merck Group (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Plvthm, by Addgene (1 mentions)
Xfect transfection reagent, by Takara Bio (1 mentions)
Plvx tre3g vector, by Takara Bio (1 mentions)
Pgex 4t 1 vector, by Takara Bio (1 mentions)
Dusp6, by Horizon Discovery (1 mentions)
Plko 1 puro lentiviral vector, by Addgene (1 mentions)
Polybrene, by Merck Group (1 mentions)
Pspax2, by Addgene (1 mentions)
Pmd2 g, by Addgene (1 mentions)
7 protocols using plvx dsred monomer n1 vector
1
Inducible AURKA Knockdown Cloning
2
Lentiviral Overexpression of ABCB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length human ABCB1 cDNA was amplified from the cDNA library of QGY-7703 cells and subcloned into pLVX-DsRed-Monomer-N1 vector purchased from Clontech. Lentiviruses produced in 293T cells were used to infect SMMC-7721 and QGY-7703 cells by spinfection (500× g for 1.5 h), and the infected cells were incubated overnight, followed by selection with 2 μg/ml of puromycin (P8833, Sigma-Aldrich) for 2 weeks. Stable overexpression of ABCB1 was validated by Western blotting and qPCR.
3
Lentiviral Overexpression and Knockdown of TROAP in HCC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length human TROAP cDNA was amplified from the cDNA library of QGY-7703 cells and subcloned into a pLVX-DsRed-Monomer-N1 vector purchased from Clontech (Mountain View, CA, USA). Lentivirus produced in 293T cells was used to infect SMMC-7721 and QGY-7703 human HCC cells by spinfection (500 × g for 1.5 h) and incubated overnight, followed by selection with 2 μg/ml of puromycin (P8833; Sigma-Aldrich, St. Louis, MO, USA) for 2 weeks. Stable overexpression of TROAP was validated by Western blotting.
Two targeting TROAP siRNA duplexes (TROAP RNA#1, 5′-GTAGGATTGAGCCTGAGAT-3′; TROAP RNA#2, 5′-GGAACAGCTTGAAGTACCA-3′) were obtained from RiboBio Company (Guangzhou, P.R. China) and gave consistent results. SMMC-7721 and QGY-7703 were transfected with 100 nM siRNA using Lipofectamine RNAiMAX according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). Seventy-two hours later, the RNA interference was confirmed using Western blotting.
Two targeting TROAP siRNA duplexes (TROAP RNA#1, 5′-GTAGGATTGAGCCTGAGAT-3′; TROAP RNA#2, 5′-GGAACAGCTTGAAGTACCA-3′) were obtained from RiboBio Company (Guangzhou, P.R. China) and gave consistent results. SMMC-7721 and QGY-7703 were transfected with 100 nM siRNA using Lipofectamine RNAiMAX according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). Seventy-two hours later, the RNA interference was confirmed using Western blotting.
4
Bmi-1 Overexpression and IκBα Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shRNA sequences against IκBα (5′-CCGGATCACCAACCAGCCAGAAATTCTCGAGAATTTCTGGCTGGTTGGTGATTTTTT) were cloned into pLVTHM (Addgene). The pLVX-DsRed-Monomer-N1-Bmi-1 vector was constructed by inserting Bmi-1 cDNA containing stop codon into the XhoI and BamHI sites of the pLVX-DsRed-Monomer-N1 vector (Clontech).
5
Generating Stable TET1-CXXC Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CXXC domain (amino acid 528-674) of TET1 was amplified from cDNA of undifferentiated ReNcell VM. The 441 bp amplicon containing EcoRI/XhoI restriction enzyme sites was cloned into pAAV-IRES-hrGFP vector harboring 3X flag tag (Clontech Laboratories Inc., Mountain View, CA, USA). To generate the ReNcell VM stably overexpressing the TET1-CXXC domain, the cDNA encoding TET1-CXXC-flag from pAAV-IRES-hrGFP vector was subcloned into EcoRI/ApaI sites of pLVX-DsRed-Monomer-N1 vector (Clontech Laboratories Inc.). The catalytic domain of TET1 (amino acids 1418-2136) and its inactive catalytic form cloned in pAAV-EF1a-HA-hTET1CD-WPRE-PolyA vector were a kind gift from Hongjun Song (Addgene plasmids # 39454 and 39455). According to the manufacturer’s instructions, ReNcell VM or HEK293T cells were transfected with plasmid DNA using X-fect transfection reagent (Clontech Laboratories Inc., PT5003-2).
6
VLDLR, LDLR, and RAP Protein Expression Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pLVX-flag was a gift from Dr. Tao Guo (The First Affiliated Hospital, Dalian Medical University, Dalian, China). pLVX-mVenus-p27K- was a gift from Dr. Bing Liu (Institute of Cancer Stem Cell, Cancer Center, Dalian Medical University, Dalian, China). VLDLR-I, VLDLR-II, LDLR, and RAP fragments were cloned from human genome cDNA. The primers were as follows: VLDLR-I/II: Forward, 5′-CTACCGGACTCAGATGCCACCATGGGCACGTCCGCGCTCT; Reverse, 5′-TACCCGGTAGAATTATCTAGATCAAGCTAGATCATCATCT. LDLR: Forward, 5′-CCGCGGCCGCGCCACCATGGGGCCCTGGGGCTGGAA; Reverse, 5′-TCCATATGTCACGCCACGTCATCCTCCA. RAP: Forward, 5′-GATCTGGTTCCGCGTGGATCCATGGCGCCGCGGAGGGTCA; Reverse, 5′-GTCACGATGCGGCCGCTCGAGTCAGAGTTCGTTGTGCCGA. DsRed fragment was replaced by the VLDLR-I/II fragment in the pLVX-DsRed-Monomer-N1 vector (Clontech). The LDLR fragment was ligated into the pLVX-TRE3G vector (Clontech). The RAP fragment was recombinated into the pGEX-4T-1 vector (Clontech). The shRNAs specifically targeting VLDLR were cloned into the pLKO-Tet-On-shNC vector. The primers were as follows: shVLDLR-1: Forward, 5′-CCGGGCACAGATGATGATCTAGCTTCTCGAGAAGCTAGATCATCATCTGTGCTTTTTG; Reverse, 5′-AATTCAAAAAGCACAGATGATGATCTAGCTTCTCGAGAAGCTAGATCATCATCTGTGC. shVLDLR-2: Forward, 5′-CCGGGCTTGATTCTAAGTTGCACATCTCGAGATGTGCAACTTAGAATCAAGCTTTTTG; Reverse, 5′-AATTCAAAAAGCTTGATTCTAAGTTGCACATCTCGAGATGTGCAACTTAGAATCAAGC.
7
Lentiviral Manipulation of LINC01503
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LINC01503 was cloned into the pLVX-DsRed-Monomer-N1 Vector (lentiviral expression vector, Clontech, Fremont, CA). The pLKO.1-LINC01503-shRNA was generated by inserting double-stranded oligonucleotides into pLKO.1-puro lentiviral vector (Addgene, Cambridge, MA; #8453), and was confirmed by DNA sequencing. Recombinant lentiviral vectors and packaging vectors, psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259), were co-transfected into 293T cells using polyethylenimine transfection reagent. Supernatants containing viral particles were harvested 48 hours after transfection; indicated cells were infected with the lentiviruses in the presence of 8 mg/mL Polybrene (Sigma-Aldrich, St Louis, MO).
Expression plasmids including pCMV-HA-Ebp1 (plasmid #67792) and DUSP6 (plasmid #27975) were obtained from Addgene. Small interfering RNA (siRNA) Smartpools against LINC01503, FAM83H-AS, MIR205HG, PVT1, DUSP-6, and EBP-1 were obtained from GE Dharmacon (Lafayette, CO). DNA vectors and siRNAs were transfected into cells using Bio-T transfection reagent (Bioland Scientific) or Lipofectamine RNAiMAX (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions. The cloning primers, short hairpin RNA (shRNA) sequence and siRNA sequence are listed in Supplementary Table 1.
Expression plasmids including pCMV-HA-Ebp1 (plasmid #67792) and DUSP6 (plasmid #27975) were obtained from Addgene. Small interfering RNA (siRNA) Smartpools against LINC01503, FAM83H-AS, MIR205HG, PVT1, DUSP-6, and EBP-1 were obtained from GE Dharmacon (Lafayette, CO). DNA vectors and siRNAs were transfected into cells using Bio-T transfection reagent (Bioland Scientific) or Lipofectamine RNAiMAX (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions. The cloning primers, short hairpin RNA (shRNA) sequence and siRNA sequence are listed in Supplementary Table 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!