Universal 18s primers

Manufactured by Thermo Fisher Scientific

Universal 18s primers are oligonucleotide sequences designed to amplify and detect the 18S ribosomal RNA gene, which is commonly used as a reference gene for gene expression studies. These primers are designed to work across a wide range of species, making them a versatile tool for various applications in molecular biology and genetics.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (6 mentions) Rneasy mini kit, by Qiagen (5 mentions) Cdna synthesis kit, by Bio-Rad (2 mentions) Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions) Sybr green, by Quanta Biosciences (1 mentions) Abi prism 7300, by Thermo Fisher Scientific (1 mentions) Qscript cdna supermix, by Quanta Biosciences (1 mentions) Iscript dna synthesis kit, by Bio-Rad (1 mentions) Iscript cdna synthesis kit, by Bio-Rad (1 mentions)

Spelling variants of this product

18S primers (7 citations) 18S universal primer pair (2 citations)

5 protocols using universal 18s primers

Quantifying TXNIP gene expression in mouse and human islets

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using TRIzol (ThermoFisher Scientific) and a RNeasy Mini kit (Qiagen, Valencia, CA). Purified RNA (500 ng), an absorbance ratio of A260/A280 between 1.8 and 2.0, was converted into cDNA using qScript cDNA Supermix (Quanta Biosciences, Gaithersburg, MD) for mouse islets and SuperScript III First-Strand Synthesis System (ThermoFisher Scientific) for human islets. TXNIP gene expression was quantified using SYBR green (Quanta Biosciences) on an ABI Prism 7300 (Applied Biosystems, Foster City, CA) detection system and values were normalized to 18S. The mouse primers for TXNIP were forward: 5′-TCTTTTGAGGTCGTCTTCAACG-3′ and reverse: 5′-GCTTTGACTCGGTAACTTCACA-3’and the human primers were forward: 5′-ATATGGGTGTGTAGACTACTGGG-3′ and reverse: 5′-GACATCCACCAGATCCACTACT-3′ (Integrated DNA Technologies, Coralville, IA). Universal 18S primers were purchased from ThermoFisher Scientific.

Kim Y., Rouse M., González-Mariscal I., Egan J.M, & O’Connell J.F. (2019). Dietary curcumin enhances insulin clearance in diet-induced obese mice via regulation of hepatic PI3K-AKT axis and IDE, and preservation of islet integrity. Nutrition & Metabolism, 16, 48.

+ Open protocol

+ Expand

Gene Expression Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using Trizol (Invitrogen, cat 15596018), chloroform and RNeasy Mini kit (Qiagen, cat 74106) as previously (9). cDNA was prepared using cDNA synthesis kit (Bio-Rad, cat. No. 1708891). Gene expression was quantified using SYBR green method of qPCR on an ABI StepOnePlus sequence detection system using fast conditions. Samples were normalized against the 18s gene using Universal 18s primers (ThermoFisher, AM1718). Expression was calculated using the standard curve method according to the manufacturer’s protocol (Perkin Elmer, Waltham, MA, USA). Primers used were: WNT5A forward, 5′ ATT CTT GGT GGT CGC TAG GTA 3′; WNT5A reverse, 5′ CGC CTT CTC CGA TGT ACT GC 3′; TP53 forward, 5’ GTG GAA GGA AAT TTG CGT GT3’; TP53 reverse, 5’ CCA GTG TGA TGA TGG TGA GG3’; KDM5B forward1, 5’ CCATAGCCGAGCAGACTGG3’; KDM5B reverse1, 5’ GGA TAC GTG GCG TAA AAT GAA GT3’; KDM5B forward2, 5’ CAA TGC TGT GGA CCT GTA TGT; KDM5B reverse2, 5’ TAC GGA GGG TAT AGT CCC TGG3’; PUMA forward, 5’ GTC CCC TGC CAG ATT TGT G3’; PUMA reverse, 5’AGA GGC CGC AGG ACA CTG3’; TP53 F mouse AAG ATC CGC GGG CGT AA3’; TP53 R mouse 5’ CAT CCT TTA ACT CTA AGG CCT CAT TC3’; Cyclophilin A F 3’ GGG TTC CTC CTT TCA CAG AA5’; Cyclophilin A R 3’ GAT GCC AGG ACC TGT ATG CT5’.

Webster M.R., Fane M.E., Alicea G.M., Basu S., Kossenkov A.V., Marino G.E., Douglass S.M., Kaur A., Ecker B.L., Gnanapradeepan K., Ndoye A., Kugel C., Valiga A., Palmer J., Liu Q., Xu X., Morris J., Yin X., Wu H., Xu W., Zheng C., Karakousis G.C., Amaravadi R.K., Mitchell T.C., Almeida F.V., Xiao M., Rebecca V.W., Wang Y.J., Schuchter L.M., Herlyn M., Murphy M.E, & Weeraratna A.T. (2019). Paradoxical role for wild type p53 in driving therapy resistance in melanoma. Molecular cell, 77(3), 633-644.e5.

+ Open protocol

+ Expand

Comprehensive Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using Trizol (Invitrogen, cat 15596018), chloroform and RNeasy Mini kit (Qiagen, cat 74106) as previously (9). cDNA was prepared using cDNA synthesis kit (Bio-Rad, cat. No. 1708891) . Gene expression was quantified using SYBR green method of qPCR on an ABI StepOnePlus sequence detection system using fast conditions. Samples were normalized against the 18s gene using Universal 18s primers (ThermoFisher, AM1718). Expression was calculated using the standard curve method according to the manufacturer's protocol (Perkin Elmer, Waltham, MA, USA). Primers used were: WNT5A forward, 5′ ATT CTT GGT GGT CGC TAG GTA 3′; WNT5A reverse, 5′ CGC CTT CTC CGA TGT ACT GC 3′; TP53 forward, 5' GTG GAA GGA AAT TTG CGT GT3'; TP53 reverse, 5' CCA GTG TGA TGA TGG TGA GG3'; KDM5B forward1, 5' CCATAGCCGAGCAGACTGG3'; KDM5B reverse1, 5' GGA TAC GTG GCG TAA AAT GAA GT3'; KDM5B forward2, 5' CAA TGC TGT GGA CCT GTA TGT; KDM5B reverse2, 5' TAC GGA GGG TAT AGT CCC TGG3'; PUMA forward, 5' GTC CCC TGC CAG ATT TGT G3'; PUMA reverse, 5'AGA GGC CGC AGG ACA CTG3'; TP53 F mouse AAG ATC CGC GGG CGT AA3'; TP53 R mouse 5' CAT CCT TTA ACT CTA AGG CCT CAT TC3'; Cyclophilin A F 3' GGG TTC CTC CTT TCA CAG AA5'; Cyclophilin A R 3' GAT GCC AGG ACC TGT ATG CT5'.

Webster M.R., Fane M.E., Alicea G.M., Basu S., Kossenkov A.V., Marino G.E., Douglass S.M., Kaur A., Ecker B.L., Gnanapradeepan K., Ndoye A., Kugel C.H., Valiga A.A., Palmer J., Liu Q., Xu X., Morris J., Yin X., Wu H., Xu W., Zheng C., Karakousis G.C., Amaravadi R.K., Mitchell T.C., Almeida F.V., Xiao M., Rebecca V.W., Wang Y.J., Schuchter L.M., Herlyn M., Murphy M.E., & Weeraratna A.T. (2020). Paradoxical Role for Wild-Type p53 in Driving Therapy Resistance in Melanoma. Molecular Cell, 77(3), 681-681.

+ Open protocol

+ Expand

Quantifying autophagy and Wnt5a gene expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

As previously described RNA was extracted using Trizol (Invitrogen) and the RNeasy Mini kit (Qiagen) (36 (link)). cDNA was then prepared using the iscript DNA synthesis kit (Bio-Rad, cat no. 1708891). SYBR Green dye-based PCR amplification was used to measure gene expression; qPCR was performed using the ABI StepOnePlus apparatus. The mRNA levels of samples were normalized with the mRNA levels of 18S using Universal 18S primers (Invitrogen, cat. No. AM1718). mRNA expression was determined using the standard curve method recommended by the manufacturer’s protocol (Perkin Elmer, Waltham, MA). Primers used are: ATG5 Forward, 5’ GGC CAT CAA TCG GAA ACT CAT 3’; ATG5 Reverse, 5’ AGC CAC AGG ACG AAA CAG CTT 3’; ATG12 Forward, 5’ TAG AGC GAA CAC GAA CCA TCC 3’; ATG12 Reverse, 5’ CAC TGC CAA AAC ACT CAT AGA GA 3’; WNT5A Forward, 5’ ATT CTT GGT GGT CGC TAG GTA 3’; WNT5A Reverse, 5’ CGC CTT CTC CGA TGT ACT GC 3’.

Ndoye A., Budina-Kolomets A., Kugel CH I.I.I., Webster M., Kaur A., Behera R., Rebecca V., Li L., Brafford P., Liu Q., Gopal Y.N., Davies M.A., Mills G.B., Xu X., Wu H., Herlyn M., Nicastri M., Winkler J., Soengas M.S., Amaravadi R., Murphy M, & Weeraratna A.T. (2017). ATG5 mediates a positive feedback loop between Wnt signaling and autophagy in melanoma. Cancer research, 77(21), 5873-5885.

+ Open protocol

+ Expand

Quantifying Klotho and Wnt5a Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using Trizol (Invitrogen) and RNeasy Mini kit (Qiagen)
as previously described (18 ). cDNA was
prepared using iscript cDNA synthesis kit (Bio-Rad, cat. No. 1708891). Gene
expression was quantified using SYBR green method of qPCR and mRNA levels were
compared to standard curves. qPCR was performed on an ABI StepOnePlus sequence
detection system using fast conditions and samples were normalized against the
18S gene, using Universal 18S primers (Invitrogen, cat. No. AM1718). Expression
was calculated using the standard curve method according to the
manufacturer’s protocol (Perkin Elmer, Waltham, MA). The sequences for
primers are Klotho forward primer: GCTCTCAAAGCCCACATACTG; Klotho reverse primer:
GCAGCATAACGATAGAGGCC Wnt5a forward primer: AGGGCTCCTACGAGAGTGCT; Wnt5a reverse
primer: GACACCCCATGGCACTTG.

Behera R., Kaur A., Webster M.R., Kim S., Ndoye A., Kugel CH I.I.I., Alicea G.M., Wang J., Ghosh K., Cheng P., Lisanti S., Marchbank K., Dang V., Levesque M., Dummer R., Xu X., Herlyn M., Aplin A.E., Roesch A., Caino C., Altieri D.C, & Weeraratna A.T. (2017). Inhibition of age-related therapy resistance in melanoma by rosiglitazone-mediated induction of Klotho. Clinical cancer research : an official journal of the American Association for Cancer Research, 23(12), 3181-3190.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!