Anti tetra his antibody

Manufactured by Qiagen

Sourced in Germany

The Anti-tetra His antibody is a laboratory reagent used for the detection and purification of recombinant proteins that contain a polyhistidine (His) tag. It specifically binds to the tetrahistidine (tetra-His) sequence, which is commonly used as an affinity tag for protein expression and purification.

Automatically generated - may contain errors

Lab products found in correlation

Hrp conjugated anti mouse igg antibody, by Bio-Rad (1 mentions) Tissue tek oct, by Sakura Finetek (1 mentions) Anti atp5a1 antibody, by Abcam (1 mentions) Anti gapdh antibody, by Proteintech (1 mentions) L arabinose, by Merck Group (1 mentions) Biacore t200, by GE Healthcare (1 mentions) Surfactant p20, by GE Healthcare (1 mentions) Fcγ receptors, by R&D Systems (1 mentions) Prism 6, by GraphPad (1 mentions) Microtiter plate reader, by Agilent Technologies (1 mentions) Swine anti rabbit hrp conjugated antibody, by Agilent Technologies (1 mentions) Hrp conjugated anti mouse antibody, by Agilent Technologies (1 mentions) Rabbit anti human fibrinogen antibody, by Agilent Technologies (1 mentions) 3 3 5 5 tetramethylbenzidine (tmb), by Agilent Technologies (1 mentions) Sulfuric acid, by Fujifilm (1 mentions) Superblock, by Thermo Fisher Scientific (1 mentions) 96 well plate, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Tetra·His Antibody Anti-tetra-HIS Tetra-His Anti-His antibody

9 protocols using anti tetra his antibody

Histochemical Analysis of Atherosclerotic Lesions

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Atherosclerotic lesion specimens of human aortas were embedded in Tissue-Tek OCT (Sakura Finetek, Tokyo, Japan), snap-frozen in liquid nitrogen and stored at −80 °C. The tissues were sectioned and fixed with cold acetone. The sections were treated with the following primary antibody molecules: mouse anti-GA-pyridine monoclonal antibody, 2A2 (Cosmo Bio, Tokyo, Japan) [22 (link),31 (link)] or AGE73scFv. The sections treated with AGE73scFv were further incubated with anti-tetra His antibody (QIAGEN) as the secondary antibody. All sections were subsequently treated with an HRP-conjugated anti-mouse IgG antibody (Bio-Rad, Hercules, CA, USA), and visualized with 3,3′-diaminobenzidine.

Fukuda N., Noi K., Weng L., Kobashigawa Y., Miyazaki H., Wakeyama Y., Takaki M., Nakahara Y., Tatsuno Y., Uchida-Kamekura M., Suwa Y., Sato T., Ichikawa-Tomikawa N., Nomizu M., Fujiwara Y., Ohsaka F., Saito T., Maenaka K., Kumeta H., Shinya S., Kojima C., Ogura T, & Morioka H. (2017). Production of Single-Chain Fv Antibodies Specific for GA-Pyridine, an Advanced Glycation End-Product (AGE), with Reduced Inter-Domain Motion. Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 22(10), 1695.

+ Open protocol

+ Expand

Biotin Switch Assay for S-Nitrosation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The biotin switch assay was carried out as described previously with some modifications [16 ]. Cells or liver tissue was homogenized in HEN buffer (250 mM Hepes-NaOH pH 7.7 supplemented with 1 mM EDTA, 0.1 mM neocuproine) containing 150 μM deferoxamine, 1% Nonidet-P40 (NP-40), and protease/phosphatase inhibitors. Homogenized samples were sonicated and centrifuged at 16,000 g for 15 min at 4°C. The supernatant samples were placed into 10K molecular weight concentrator and the retentates were used for protein determination. Lysates were diluted to reach 5.5 mg/ml final protein concentration and were added to HEN buffer supplemented with 2.5% SDS and 20 mM methyl methanethiosulfonate (MMTS). The samples were frequently shaked at 50°C for 25 min. Then, the MMTS was removed by adding acetone and in the meanwhile, the proteins were also precipitated at −20°C for 45 min. Pellets were resuspended in HEN buffer containing 1 % SDS and 4 mM biotin-N-[6-(biotinamido) hexyl]-3′-(2′-pyridyldithio) propinamide (HPDP). After 3-hour-long incubation at 25°C, biotinylated proteins were purified by streptavidin-agarose beads. The biotinylated proteins were eluted in 2× Laemmeli sample buffer and subjected to Western blotting with anti-ATP5A1 antibody (Abcam, Cambridge, MA, USA), anti-GAPDH antibody (Proteintech Group, Inc., Rosemont, IL) or anti-tetra His antibody (Qiagen, Hilden, Germany).

Módis K., Ju Y., Ahmad A., Untereiner A.A., Altaany Z., Wu L., Szabo C, & Wang R. (2016). S-sulfhydration of ATP synthase by hydrogen sulfide stimulates mitochondrial bioenergetics. Pharmacological research, 113(Pt A), 116-124.

+ Open protocol

+ Expand

Probing DnaK Variants in E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

ΔdnaK E. coli^{35 (link)} were transformed with plasmids containing l-arabinose-inducible 6xHis-tagged dnaK variants or the empty vector. A single colony was cultured overnight in Luria Broth at 30 °C. The OD value of each culture was then adjusted to 0.5 and the expression of DnaK variants was induced by 20 μM l-arabinose (Sigma Aldrich) for 2 hours at 30 °C. 3-fold serial dilutions were spotted onto LB-agar plates. Plates were then incubated at 30 °C or 40 °C overnight. DnaK expression levels after l-arabinose induction for 2 hours were verified by immunoblotting using anti-Tetra-His antibody (QIAGEN).

Taylor I.R., Assimon V.A., Kuo S.Y., Rinaldi S., Li X., Young Z.T., Morra G., Green K., Nguyen D., Shao H., Garneau-Tsodikova S., Colombo G, & Gestwicki J.E. (2020). Tryptophan scanning mutagenesis as a way to mimic the compound-bound state and probe the selectivity of allosteric inhibitors in cells. Chemical Science, 11(7), 1892-1904.

+ Open protocol

+ Expand

Fc Hexamer Binding Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Surface plasmon resonance binding analysis was performed using a Biacore T200 (GE Healthcare). In all, ≈3000 response units of Anti-Tetra His Antibody (Qiagen) were immobilized on a CM5 Sensor Chip via amine coupling chemistry. HBS-EP+ buffer (10 mM HEPES pH 7.4, 0.15 M NaCl, 3 mM EDTA, 0.05% Surfactant P20; GE Healthcare) was used as the running buffer. At the start of each cycle the Fcγ receptors (R&D Systems) were captured to a different flow cell at approximately 250 response units and the baseline was allowed to stabilize. Fc hexamers were titrated over each receptor at concentrations from 7.8 to 1000 nM using a 60 μl injection at 30 μl/min. The surface was regenerated by 2 × 10 μl injections of 50 mM HCl, separated by a 5 μl injection of 5 mM NaOH at a flow rate of 10 μl/min. Reference subtraction was performed using a blank flow cell and blank analyte injections. The binding response 5 s prior to the end of the analyte injection (following blank subtraction) was plotted against Fc hexamer concentration and presented using GraphPad Prism 6.

Rowley T.F., Peters S.J., Aylott M., Griffin R., Davies N.L., Healy L.J., Cutler R.M., Eddleston A., Pither T.L., Sopp J.M., Zaccheo O., Fossati G., Cain K., Ventom A.M., Hailu H., Ward E.J., Sherington J., Brennan F.R., Fallah-Arani F, & Humphreys D.P. (2018). Engineered hexavalent Fc proteins with enhanced Fc-gamma receptor avidity provide insights into immune-complex interactions. Communications Biology, 1, 146.

+ Open protocol

+ Expand

Binding Assay for Nectin-1 and CD96 Interaction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nectin-1(143t)-MPB was purified from bacterial extract as described previously [18 (link)]. Purified Nectin-1(143t)-MPB was diluted to 10 μg/ml in PBS and used to coat 96-well ELISA plates overnight at 4°C. Control wells included only milk proteins. Plates were washed with 0.1% Tween 20 in PBS (PBS-Tween) and incubated in blocking solution (PBS-Tween with 5% milk) for 1 h at room temperature (RT). Plates were washed with PBS-Tween and incubated with various concentrations of hCD96(516t) in blocking solution for 3 h at RT. Plates were washed with PBS-Tween and incubated in blocking solution containing anti-tetra-His antibody (QIAgen) at 0.2 μg/ml for 1 h at RT. After being washed with PBS-Tween, the plates were incubated with horseradish peroxidase-conjugated secondary anti-mouse Ig antibody at 0.2 μg/ml in blocking solution for 30 min at RT. Plates were then washed with PBS-Tween and with 20 mM citrate buffer (pH 4.5). The horseradish peroxidase substrate [2,2′-azinobis(3-ethylbenzthiazolinesulfonic acid); Moss, Inc.] in citrate buffer (pH 4.5) was added, and the absorbance at 405 nm was read with a microtiter plate reader (Bio-Tek).

Holmes V.M., Maluquer de Motes C., Richards P.T., Roldan J., Bhargava A.K., Orange J.S, & Krummenacher C. (2019). Interaction between nectin-1 and the human natural killer cell receptor CD96. PLoS ONE, 14(2), e0212443.

+ Open protocol

+ Expand

Quantifying Protein-ECM Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

ECM proteins in coating buffer (50 μl) were added to wells of a high‐binding 96‐well plate (Immulon 2HB) and incubated for 16 hr at 4°C. Wells were washed once in TBSC and non‐specific binding sites were blocked with 3% BSA in TBSC for 1 hr at 37°C. Wells were washed once in TBSC and recombinant protein (0–5 μg) diluted in TBSC was applied to the wells and incubated for 1 hr at 37°C. Unbound protein was removed and wells washed once in TBS. Primary antibody diluted in TBST was added to the wells and incubated for 1 hr at 37°C. Wells were washed twice in TBST before adding HRP‐linked secondary antibody diluted in TBST containing 3% BSA and incubating for 1 hr at 37°C. Wells were washed once in TBST, twice in TBS, and detection reagent (0.102 M Na₂HPO₄, 0.049 M citric acid, 0.012% H₂O₂, 3.7 mM o‐phenylenediamine) was added to wells. Plates were incubated in the dark for 10 min at room temperature, 0.56 M H₂SO₄ was added to stop the reactions and A₄₉₀ measured. x6His‐tagged proteins were detected using anti‐tetraHis antibody (Qiagen) at 1:1000 dilution and HRP‐conjugated anti‐mouse antibody (Dako) at 1:2000 dilution. Fibrinogen was detected using rabbit anti‐human fibrinogen antibody (Dako) at 1:1000 dilution and HRP‐conjugated swine anti‐rabbit antibody (Dako) at 1:2000 dilution.

Haworth J.A., Jenkinson H.F., Petersen H.J., Back C.R., Brittan J.L., Kerrigan S.W, & Nobbs A.H. (2016). Concerted functions of Streptococcus gordonii surface proteins PadA and Hsa mediate activation of human platelets and interactions with extracellular matrix. Cellular Microbiology, 19(1), e12667.

+ Open protocol

+ Expand

Quantifying IgG4 Mutant-FcγR Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

The binding activity of IgG4 mutants toward a series of soluble FcγRs was measured using enzyme-linked immunosorbent assay (ELISA). ELISA plates were coated with 5 μg/mL of anti-tetra-His antibodies (Qiagen) in a carbonate–bicarbonate buffer (Sigma). After blocking with Super Block (Thermo Scientific), purified receptors were added, and the plates were incubated overnight at 4°C. Subsequently, the wells were washed with PBS containing 0.05% Tween 20 (wash buffer), and then serial dilutions of IgGs in 10% Block Ace were added and incubated at room temperature for 2 h. Lastly, after washing with the wash buffer, bound IgGs were detected using peroxidase-labeled goat anti-human kappa antibodies (Southern Biotech) with TMB+ (Dako) as the substrate. The reaction was stopped by adding 0.5 M sulfuric acid (Wako), and the absorbance at 450 nm was measured on an ARVO plate reader (Perkin Elmer).

Namisaki H., Saito S., Hiraishi K., Haba T., Tanaka Y., Yoshida H., Iida S, & Takahashi N. (2020). R409K mutation prevents acid-induced aggregation of human IgG4. PLoS ONE, 15(3), e0229027.

+ Open protocol

+ Expand

Recombinant Expression of EsLBP1 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

The complete open reading frame of EsLBP1 was amplified from E. scolopes cDNA using primers LBP1pBAC3F (5′ATACACCATGGTAATGTCTTGCCCCACTCAA3′) and LBP1pBAC3R (5′TATCACTCGAGAATAGATGTAATTGCCAAGTC3′). Two single-nucleotide polymorphism (SNPs) resulting in amino acid substitutions relative to the published EsLBP1 sequence, T253S (a change of T to S at position 253) and A218T, were consistently noted in this cDNA preparation and were included in the expressed recombinant EsLBP1. The PCR product was digested with EcoRI and XhoI and ligated into the plasmid pBAC-3 (EMD Millipore, Billerica, MA), adding a leader peptide and His₆ tag, and sequenced. The construct was transfected into and expressed from Sf9 insect cells by Kinnakeet Biotechnology (Midlothian, VA). Conditioned medium from these cells was blotted with anti-tetra-His antibodies (Qiagen), by which means the concentration of EsLBP1 in the undiluted medium was estimated at 2 µM. Control medium including His-tagged E. coli β-glucuronidase was prepared from cells transfected with the BacMagic3 transfection control plasmid (EMD Millipore).

Krasity B.C., Troll J.V., Lehnert E.M., Hackett K.T., Dillard J.P., Apicella M.A., Goldman W.E., Weiss J.P, & McFall-Ngai M.J. (2015). Structural and Functional Features of a Developmentally Regulated Lipopolysaccharide-Binding Protein. mBio, 6(5), e01193-15.

+ Open protocol

+ Expand

His-Tagged CD16a Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-tetra-His antibodies (QIAGEN) dissolved in phosphate-buffered saline (PBS) were adsorbed onto a 96-well plate (Thermo Fisher Scientific). After blocking with 1% bovine serum albumin (BSA)–PBS, the soluble His-tagged CD16a were incubated in the plates at room temperature for 2 h. After washing with PBS containing 0.1% Tween 20 (wash buffer), a diluted mixed solution of the anti-Hp antibodies and the human Hp (Japan Blood Products Organization) in 1% BSA–PBS was incubated at room temperature for 2 h. The mixed solution was prepared by mixing the components in 1% BSA–PBS at a molar ratio of 1:2 and incubating for 1 h at room temperature. After washing with the wash buffer, bound antibodies were detected using goat antihuman IgG (H&L)-horseradish peroxidase (American Qualex) with ABTS. The reaction was stopped with 1% sodium dodecyl sulfate, and the absorbance at a sample wavelength of 415 nm and a reference wavelength of 490 nm was measured. IVIG (Venoglobulin IH 5% or Polyglobin-N 10%) was purchased from Japan Blood Products Organization. The soluble CD16a (158V allotype) with His-tag was prepared as described previously [22 (link)]. The effective concentration (EC₅₀) value was calculated by measuring the IgG concentration that produced 50% of the maximum absorbance. These assays were performed in duplicate and were repeated once.

Nakajima-Kato Y., Komai M., Yoshida T, & Kanai A. (2022). A novel monoclonal antibody with improved FcγR blocking ability demonstrated non-inferior efficacy compared to IVIG in cynomolgus monkey ITP model at considerably lower dose. Clinical and Experimental Immunology, 211(1), 23-30.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!