The largest database of trusted experimental protocols

21 protocols using sirna oligonucleotides

1

PADI2 Silencing in Liver and Gastric Cancers

Check if the same lab product or an alternative is used in the 5 most similar protocols
MNK-45 and Bel-7402 cell lines that were originated from liver cancer and gastric cancer, respectively, were cultured in an atmosphere of 5% CO2 at 37°C. Dulbecco’s Modified Eagle’s Medium (DMEM) contained 10% fetal calf serum, 50 U/mL penicillin and 50 μg/mL streptomycin. The siRNA oligonucleotides targeting the PADI2 gene (target sequence: 5′-CCCGTTCTTCGGCCAACGCTA-3′) were commercially obtained from Qiagen (Duesseldorf, Germany). MNK-45 and Bel-7402 tumor cells were transfected with the anti-PADI2 siRNAs at 20 nM using the HiPerFect transfection reagent (Qiagen). Transfection was conducted for 48 h. The inhibition of PADI2 expression in these cell lines was verified using real-time PCR. Transfection with Mm/Hs-MAPK1 siRNA (AATGCTGACTCCAAAGCTCTG) that specifically suppresses MAPK1 expression was prepared as positive controls, and transfection with Allstar siRNA that has no effect on any gene expression was used as negative controls.
+ Open protocol
+ Expand
2

siRNA Sequences for Gene Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The siRNAs used in this study are as follows: All Star Negative Control siRNA (Qiagen, Cat #1027280), human siSTAU1: 5′-CCUAUAACUACAACAUGAGdTdT-3′,7 (link) human siC9orf72 #1: 5′-CAUUAAUCUUUGAUGGAAAdTdT-3′,13 (link) human siC9orf72 #2: 5′-GGAAGAAUAUGGAUGCAUAdTdT-3′,13 (link) and human siHTT/REP: 5′-GCUGCUGCUGCUGCUGCUGdTdT-3′.14 (link) All siRNA oligonucleotides were synthesized by Invitrogen, USA. The oligonucleotides were deprotected and the complementary strands were annealed.
+ Open protocol
+ Expand
3

Caspase-9 Knockdown via siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Knockdown of caspase-9 was performed using siRNA oligonucleotides (Qiagen, Hilden, Germany). Briefly, cells were seeded in six-well plates (2.5 × 105 cells per well) and 200 pmol of caspase-9-specific or control siRNA were transfected the next day using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. 48 h post-transfection, knockdown efficacy was determined by western blot analysis.
+ Open protocol
+ Expand
4

Mouse Macrophage Isolation and Phagocytosis Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
For isolation of mouse macrophages, mice received an intraperitoneal injection of thioglycollate (4%). Cells were collected after 4 days by peritoneal lavage, centrifuged, resuspended in RPMI medium (10% FBS) and plated onto μ-dishes (Ibidi) for 24 h.
Human THP-1 monocytes were stimulated with PMA (300 nM, Merck) overnight to differentiate them into macrophages, which were then transfected with SR-BI-specific siRNA oligonucleotides or control oligonucleotides (Qiagen) for 48–72 h. Human neutrophils were isolated from whole blood using a density gradient separation method with dextran (3%, MW 500,000, Roth) containing HBSS/Hepes (10 mM) medium. After centrifugation, separation of the neutrophil layer and lysis of residual erythrocytes, the neutrophils were washed and resuspended in RPMI/Hepes (10 mM). Neutrophil apoptosis was induced by overnight incubation with pyocyanin (25 μM, Sigma). The apoptotic neutrophils were stained with TAMRA (50 μM, Thermo Fisher Scientific) and incubated for 30 min with macrophages at 37 °C.
CHO cells were stably transfected with the cDNA for human SR-BI14 (link). Transient transfections with different plasmids for murine SR-BI (native mSR-BI and its mutants SRCDSR and CDSRCD27 (link), donated by Margery Connelly), were performed using Lipofectamine®2000 (Thermo Fisher Scientific).
+ Open protocol
+ Expand
5

Knockdown of Nuclear Envelope Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA oligonucleotides targeted to human Sun1, Sun2, nesprin1, nesprin2, lamin A/C, and a control siRNA targeted to luciferase (GL2), as described (Wiggan et al., 2017 (link)), were obtained from Qiagen. siRNAs for individual targets produced similar phenotypes and were used interchangeably between experiments.
+ Open protocol
+ Expand
6

Targeted siRNA Knockdown of DDAH 1 and NOX-4

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA oligonucleotides targeted specifically to rat DDAH 1 and NOX-4 (Qiagen, Hilden, Germany) were used in this experiment. Cells were seeded on 6-well plate in serum free media for overnight. HiPerfect transfection reagent (Qiagen, Hilden, Germany) were used to transfect the cells with 20 nM of respective siRNAs as per the manufacturer’s instructions. Scrambled siRNA (20 nM) were used as transfection control. After the respective treatments, cells were harvested using RIPA cell lysis buffer for studying protein expressions.
+ Open protocol
+ Expand
7

RNAi Knockdown of OLMALINC in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAi knockdown of OLMALINC was carried out using four commercially prepared siRNA oligonucleotides (Qiagen) specific to different fragments of the OLMALINC transcript. Briefly, MO3.13 and SK-N-SH cells were seeded at 40% confluence in 6-well plates in antibiotic-free media and equimolar mix of four oligonucleotides was transfected using Lipofectamine 2000 and Opti-MEM I (Invitrogen) following the manufacturer’s protocol. For validation experiments MO3.13 oligodendrocytes were transfected with two individual siRNAs used previously in the four siRNA mix. Transfection efficiency was confirmed by substituting the siRNA with fluorescently labelled BLOCK-iT reagent (Invitrogen), using the same transfection procedure and this confirmed >95% transfection efficiency was achieved as assessed by fluorescence microscopy.
+ Open protocol
+ Expand
8

siRNA Oligonucleotides for Cellular Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
All small interfering RNA (siRNA) oligonucleotides in a purified and annealed duplex form were purchased from Qiagen (Valencia, CA 91355). The targeting sequences are as follows: UBXD7 (SI00455364, catalog number), 5′-CAGCACGTGCATATTCATTTA-3′; UFD1 (SI04132583), 5′-CACTGGATGATGCAGAACTTA-3′ VCP/p97 (SI030197300), 5′-AACAGCCAUUCUCAAACAGAA-3′ and control (Ctrl) siRNA (SI03650325), 5′-AAUUCUCCGAACGUGUCACGU-3′.
+ Open protocol
+ Expand
9

Cell Culture and Genetic Manipulation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
U2OS and HeLa cells from ATCC were grown in Dulbecco’s modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum (Sigma), 100 μg/ml streptomycin, and 100 U/ml penicillin (Sigma). The cells were tested for mycoplasma contamination by Bionique testing labs (http://www.bionique.com/). Qiagen siRNA oligonucleotides used to transiently deplete BARD1 and BRCA1 are listed in Extended Data Table 1. 53BP1 siRNA (s14313) was purchased from Ambion-Thermo Fisher Scientific. Transfection of siRNA, pS-Flag-SBP-BARD1res and pCMV-I-SceI-3xNLS was carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. To generate stable HeLa and U2OS cell lines expressing Flag-SBP-BARD1 or its mutants, cells were transfected with their respective plasmids (pS-Flag-SBP-BARD1WTres, pSFlag-SBP-BARD1AAEres, and pS-Flag-SBP-BARD1K140Nres) and individual clones were selected with 800 μg/ml G418.
+ Open protocol
+ Expand
10

siRNA Knockdown and Adenoviral Overexpression of BAP1 and IP3R3

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA oligonucleotides were obtained from Qiagen. GeneSoluton siRNAs targeting four different BAP1 mRNAs: Hs_BAP1_1, cat.no: SI00066696; Hs_BAP1_2, cat.no: SI00066703; Hs_BAP1_3, cat.no: SI00066710; Hs_BAP1_5, cat.no: SI03036390. GeneSoluton siRNAs targeting four different IP3R3 mRNAs (ITPR3): Hs_ITPR3_1, cat.no: SI00034580; Hs_ ITPR3_2, cat.no: SI00034587; Hs_ ITPR3_3, cat.no: SI00034594; Hs_ ITPR3_4, cat.no: SI00034601. Negative control siRNA, cat.no: 1027280. Transfection was performed with HiPerfect (Qiagen), using siRNAs at 10 nM final concentrations in 0.1% FBS medium for 24 hours. Unless otherwise specified in the Figures, a pool of the 4 different siRNAs, listed above, was used to silence BAP1 or IP3R3.
Adenoviruses expressing BAP1 and GFP were purchased from SignaGen Laboratories (Ad-BAP1, cat. no. SL175127; Ad-GFP, cat. no. SL100708). Customized adenoviruses expressing Ad-Myc-BAP1, Ad-Myc-BAP1(C91S), Ad-Myc-BAP1(W) and Ad-Myc-BAP1(L), were produced by SignaGen Laboratories using their Ad.MAX™ System. Expression plasmids for Flag-HA-BAP1, Myc-BAP1, Myc-BAP1(W), Myc-BAP1(L) and Myc-BAP1(C91S) were produced by Blue Heron Biotech. For BAP1(W), BAP1(L) and BAP1(C91S) the following nucleotide sequences were used:
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!