Rt primer mix

Fresh-frozen glioma tissues was moved out from −80°C and grinded into tissue suspension, Trizol (Invitrogen, Carlsbad, US) was applied for extracting the RNAs of total cells, then the cDNA reverse transcription is accomplished by the using of RT Primer Mix and PrimeScript RT Enzyme Mix 1 (Takara, Japan), reaction of reverse transcription included 50ng of RNA, 4ul of 5×PrimeScript Buffer, 2ul of PrimeScript RT Enzyme Mix, The reaction was incubated for 15 min at 42°C, qRT-PCR was made by SYBR Premix Ex Taq (Takara, Japan), QRT-PCR was performed according to the SYBR® Premix Ex Taq ™ II (Tli RNaseH Plus) kit instructions. Reaction conditions: 95°C pre-denaturation 30 s; 95°C denatured 5 s, 58°C annealed 34 s, For 40 cycles. GAPDH was used as an internal standard, primers sequence used as follows:
Hoxd4-F: CTAGTCGCCGGCTGCGGGAT
Hoxd4-R: TTAGTCCCCCGGAGGGTGCG
GAPDH-F: 5′- ACGGATTTGGTCGTATTGGG -3′
GAPDH-R: 5′- TCATTTTGGAGGGATCTCGC -3′
After the reaction, the SDSShell software records the number of cycles that each hole reaches the set fluorescence threshold, the CT value. The average data of the HOXD4 was analyzed by Ct (Ct = Ct HOXD4-CtGAPDH). The smaller the Ct value predicted the higher expression of HOXD4.

To further verify the accuracy of transcriptome sequencing results, 10 genes were selected for qRT-PCR validation. Primer3.0 (https://primer3.ut.ee/, accessed on 28 March 2022) was used to design primers (Table S4). Trizol was used to extract RNA from celery seed. cDNA was synthesized using Takara (Takara, Dalian, China) reverse transcription kit. The reaction contained RNA (1000 ng), PrimeScript RT Enzyme Mix I (10 µL), RT Primer Mix (1 µL), 5 × PrimerScript Buffer 2 (for Real Time) (4 µL), and RNase Free dH₂O was added to obtain a final volume of 20 µL. The qRT-PCR contained 10 µL of TB Green Premix Ex Taq (TaKaRa, Dalian, China), 0.4 µL of forward primer, 0.4 µL of reverse primer, 2 µL of cDNA, and 6.8 µL of ddH₂O. The relative expression levels of genes were calculated using 2^−∆∆CT method. GAPDH sequence was used as endogenous control. The results showed that the expression pattern of qRT-PCR results was consistent with that of transcriptome sequencing results, proving the accuracy of transcriptome sequencing results (Figure S3). Three replicates were used for each treatment.

Total RNAs from cell cultures were lysed using TRIzol® Reagent (Takara, Dalian, China), and genomic DNA was removed using the gDNA Eraser (Takara). RNA was reversely transcribed using RT Primer Mix and PrimeScript RT Enzyme Mix I (Takara). Expression analysis was performed by SYBR Green-based RT-PCR using SYBR® Premix Ex Taq II (Tli RNaseH Plus, Takara) and the 7500 RT-PCR Systems (Foster City, CA). Primers used for genes of interest were purchased from GeneCopoeia. Results were calculated using Ct values and normalized against endogenous GAPDH mRNA levels.

Total RNA was extracted from liver samples using Trizol (Invitrogen, Carlsbad, CA, USA) reagent and then was treated with DNase I (Invitrogen, USA) according to the manufacturer’s protocols. The RNA samples (1 μg) were reverse transcribed to cDNA using PrimeScript Enzyme Mix 1, RT Primer Mix and 5 × PrimerScript Buffer 2 (Takara, Dalian, China). The reverse transcription was conducted at 37 °C for 15 min, 85 °C for 5 s. Gene-specific primer sequences (Table 2) were designed using Primer 5.0 software and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Real-time PCR was performed according to the manufacturer’s instructions. Briefly, 1 μL cDNA template was added to a total volume of 10 μL containing 5 μL KAPA SYBR FAST qPCR Master Mix Universal, 0.4 μL PCR forward primer, 0.4 μL PCR reverse primer, 0.2 μL ROX low, and 3 μL PCR-grade water (Kapa biosystems, Beijing, China). The amplification procedure was as follows: 3 min at 95 °C; 3 s at 95 °C and 34 s at 60 °C for 40 cycles; 15 s at 95 °C, 1 min at 60 °C, and 15 s at 95 °C. Relative mRNA expression was normalized using reference gene β-actin and calculated using the 2^−ΔΔCt method.

Oligonucleotide primers for infectious bovine rhinotracheitis virus (IBRV), bovine viral diarrhea virus (BVDV), bovine respiratory syncytial virus (BRSV), and BPIV3 detection and identification are shown in Table 1.
Total RNA was extracted from nasal swabs or cell culture fluids of virus isolates using TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 (TaKaRa, Shiga, Japan), according to the manufacturer’s instructions. The reverse transcription was carried out in the PrimeScript™ RT reagent kit (TaKaRa, Shiga, Japan) according to the instructions using 4 μL of RNA sample and RT Primer Mix as a reverse transcription primer.
The amplification of cDNA by PCR was carried out in a total volume of 25 μL containing 2× ES Taq MasterMix (CWBIO). The reaction was heated in a thermocycle for 5 min at 94 °C and then submitted to 35 cycles of 1 min at 94 °C, 1 min at the required temperature for each primer pair (Table 1), 45 s at 72 °C, and a final 10 min incubation at 72 °C. The amplification products were sequenced by Anhui General Co. (Chuzhou, China).