Osteocyte RNA was isolated from mouse bone, using a modification of the protocol described in Qing and colleagues.(7 (link)) Femurs were dissected from day 30 (d30) mice, after the epiphyses were cut off and the diaphyses were subjected to centrifugation and flushing with PBS to remove the bone marrow. The remaining femoral cortical shafts were sequentially digested to remove osteoblasts, osteoclasts, periosteal cells, and other adherent cells. Femur cortices were subjected to three sequential digestions in 0.2% type 1 collagenase (Worthington, Lakewood, NJ)/0.05% trypsin (Thermo Fisher Scientific) in α-MEM media/25 mM HEPES/0.1% BSA. Following a PBS wash, they were incubated with 0.53 mM EDTA/0.05% trypsin in PBS/0.1% BSA, after which they were incubated with 0.2% type 1 collagenase/0.05% trypsin. Digests were shaken at 900 rpm for 30 min at 37°C in a ThermoMixer R (Eppendorf). Digested femur cortices were homogenized in Trizol (Thermo Fisher Scientific). Total RNA was isolated as described(16 (link)) and reverse transcribed with SuperScript II (Roche). Quantitative real time-PCR was performed using the QuantiTect SYBR Green RT-PCR kit (Qiagen, Hilden, Germany) on an Opticon DNA engine (MJ Research, Waltham, MA). Gene expression was normalized to that of WT for each sample, using the methods of Livak and Schmittgen.(24 (link))
Dna engine opticon
Manufactured by Bio-Rad
Sourced in United States, Germany
The DNA Engine Opticon is a real-time PCR detection system designed for quantitative gene expression analysis. It utilizes a 96-well format and supports multiple fluorescent dye detection. The core function of the DNA Engine Opticon is to amplify and detect DNA sequences in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Hp845, by Hewlett-Packard (4 mentions)
Quantitect reverse transcription kit, by Qiagen (4 mentions)
Quantitect sybr green rt pcr kit, by Qiagen (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Quick rna miniprep kit, by Zymo Research (3 mentions)
Statistica 8, by StatSoft (3 mentions)
Quanttect sybr green rt pcr kit, by Qiagen (3 mentions)
Superscript 2, by Roche (2 mentions)
Sybr green pcr reagent, by Takara Bio (2 mentions)
Du800, by Beckman Coulter (2 mentions)
Origin 7, by OriginLab (2 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (2 mentions)
Revertaid premium first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (2 mentions)
Opticon monitor 3.1 analysis software, by Bio-Rad (2 mentions)
Collagenase type 1, by Worthington (1 mentions)
Trypsin, by Thermo Fisher Scientific (1 mentions)
Thermomixer r, by Eppendorf (1 mentions)
35 protocols using dna engine opticon
1
Osteocyte RNA Isolation from Mouse Bone
2
Real-time PCR Analysis of Key Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNAbee (AMS Biotech) and reverse transcribed using Superscript III (Invitrogen). Real-time PCR analysis was performed on an Opticon DNA engine (MJ Research Inc.). The dissociation curve was analyzed for each sample. Relative level of the target sequence against the reference sequence was calculated using the ΔΔ cycle threshold method. Primer sequences were as follows: Hprt1 forward, 5′-TCAGTCAACGGGGGACATAAA-3′, Hprt1 reverse 5′-GGGGCTGTACTGCTTAACCAG-3′; Il2 forward, 5′-GTGCCTAGAAGATGAACTTGGA-3′, Il2 R 5′-AAATGTGTTGTCAGAGCCCT-3′, Dicer1 forward, 5′-TATCGCCTTCACTGCCTTCT-3′ Dicer1 reverse, 5′-TTTTCCACCCGAAGTCTAAGTT-3′; spliced Mtor forward 5′-ACCGGCACACATTTGAAGAAG-3′ Mtor reverse, 5′-CTCGTTGAGGATCAGCAAGG-3′; spliced Rictor forward, 5′-ACCGACACCATCACCATGAAG-3′ Rictor reverse, 5′-GACACCATAGACCTAACTGAGGA-3′; unspliced Mtor forward, 5′-TACCGGGTGAGAGATGGGTC-3′ Mtor reverse, 5′-CACAGTGAGCAGGAGAGAG-3′; unspliced Rictor, forward 5′-TGGTGGTAAAAGAGTGGC-3′ Rictor reverse 5′-GTGTAAGTCAGAGGACGG-3′. microRNAs were quantified using miScript RT and qPCR kits according to the manufacturer’s instructions (QIAGEN).
3
Quantification of drug-induced gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-MB-231, T47D and MCF-7 cells were treated for 72 h with 20 or 50 μM ZA, RIS, IBA, ALN as indicated and co-treated with 0.25 mM probenecid. Quantitative PCR (qPCR) was performed in 20 μl by using 1 μl of the cDNA, which was previously diluted 1:5 and 10 μl of KAPA SYBR FAST qPCR Universal Mix (Peqlab Biotechnologie GmbH, Erlangen, Germany) and 2.5 μl of primer pairs for human KLF2 or GAPDH as housekeeping gene (Quantitect Hs_KLF2_1 and Hs_GAPDH_1_SG, Qiagen GmbH, Hilden, Germany), dissolved according to the manufacturer’s instructions. The primers for 36B4, which was used as housekeeping gene, and the primers for ABCC1, ANKH, and PANX1 (see above) were obtained from biomers.net GmbH, Ulm, Germany and were used in a concentration of 1 pmol each per reaction with the following sequences in 5′-3′ direction: 36B4_qFor: TGCATCAGTACCCCATTCTATCAT; 36B4_qRev: AGGCAGATGGATCAGCCAAGA [37 (link)]. QPCR conditions were as follows: 95°C, 3 min; 40 cycles: 95°C, 15 s; 60°C, 15 s; 72°C, 20 s; followed by melting curve analysis for specificity of qPCR products. QPCR was performed with the Opticon DNA Engine (MJ Research, Waltham, USA). Data were obtained from three independent experiments and qPCRs were performed three times. Results were calculated with the Relative Expression Software Tool (REST 2009 V2.0.13) obtained from Qiagen GmbH [38 (link)].
4
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from 0.5 × 105 to 1 × 107 cells using the RNeasy protocol, as recommended by the manufacturer (RNeasy, Qiagen, Valencia CA, USA), and cDNA produced using a mixture of random hexamers and oligo dT priming (iScript reverse transcriptase, Biorad, Hercules, CA, USA). Quantitative PCR was carried out in triplicate using the Quantitect SYBR Green master mix kit (Qiagen, Valencia, CA, USA) according to the manufacturers recommendations, in an Opticon DNA Engine (MJ Research, Reno, NV, USA). Primer sequences used are as follows:
c-myc F: 5′-TCGGATTCTCTGCTCTCCTCG-3′
c-myc R: 5′-CTGCGTAGTTGTGCTGATGTGTG-3′
p21 F: 5′-ACAGCAGAGGAAGACCATGTGG-3′
Line-1 F: 5′-GCTGGATATGAAATTCTGGGTTGA-3′
Line-1 R: 5′-AGGAAATACAGAGAACGCCACAA-3′
CrabpI F: 5′-GGACGCAAGTGCAGGAGTTTA-3′
CrabpI R: 5′-GCGCCAAACGTCAGGATAA-3′
GAPDH F: 5′-CCAAAATCAAGTGGGGCGATG-3′
GAPDH R: 5′-AAAGGTGGAGGAGTGGGTGTCG-3′.
5
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the hydrogel constructs at days 3, 7, 14 and 21, and 2 μg RNA from each group used for reverse transcription using random hexamer primers (Table 2 ) and BioScript reverse transcriptase (Bioline GmbH, Luckenwalde, Germany). Quantitative PCR (qPCR) was performed in triplicate with 1 μL cDNA, 10 μL KAPA SYBR FAST Universal 2x qPCR Master Mix (peqlab Biotechnologie GmbH) and 1 μL of gene specific primers. Eventually, qPCR was performed with Opticon DNA Engine (MJ Research, Waltham, USA) under the following conditions: 95°C for 3 min; 40 cycles: 95°C for 15 s; 58°C for 20 s; 72°C for 30 s; thereafter the melting curve was analyzed. Final results were calculated using the Δ Δ-CT method.
6
Quantifying Periarticular Chondrocyte PTHrP mRNA
7
Endogenous IFITM3 Knockdown in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell selection was performed by adding puromycin to the cell culture medium, following which the resistant monoclonal colonies were identified. The efficiency of endogenous IFITM3 KD in the HeLa cells were confirmed by RT-PCR analysis. The re-cultured HeLa cells were harvested and RNA was extracted using a standard TRIzol procedure (Invitrogen; Thermo Fisher Scientific, Inc.; cat. no. 15596-018). The RNA was subjected to cDNA synthesis using M-MLV reverse transcriptase (Promega; Madison, WI, USA; cat. no. M170) in a 20 µl liquid phase reaction, from which 1 µl of cDNA was used for subsequent PCR amplification. The primers used as an internal control for RT-PCR to amplify human 18S were as follows: Forward 5'-GGA AGG GCA CCA CCA GGA GT and reverse 5'-TGC AGC CCC GGA CAT CTA AG. The primers used for amplifying the IFITM3 and IFITM3-targeted RNAs via PCR analysis (Opticon® DNA engine; MJ Research, Waltham, MA, USA, cat. no. CFD3200) are listed in Table I. SYBR Premix Ex Taq II (Takara Biotechnology Co., Ltd. Dalian, China) were used for quantitative (q) PCR in a 25 µl reaction volume with 95˚C for 30 sec followed by 40 cycles with each cycle consisting of 95˚C for 5 sec and 60˚C 30 sec. Relative expression ratio of targeted genes were analyzed using the 2 -∆∆Cq method (13) with 18S as a reference gene.
8
Colonic RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Colonic samples (0.1 g) were homogenized in 1 ml of the TRIzol reagent (Invitrogen), and total RNA was extracted following the manufacturer’s instructions. The concentration and purity of the RNA were analysed spectrophotometrically (Beckman Coulter DU800; Beckman Coulter Inc.); the OD260:OD280 ratio (where OD is the optical density) ranged from 1.8 to 2.0 for all samples. The RNA integrity was measured by formaldehyde gel electrophoresis, with the 28S:18S ribosomal RNA band ratio ≥1.8. The RNA samples were reverse transcribed into complementary DNA using the PrimeScripteTM RT reagent kit (Takara) according to the manufacturer’s instructions. The primers commercially synthesized by Life Technologies Limited are listed in Table S2 . Real-time PCR for the quantification was performed on the Opticon DNA Engine (Bio-Rad) using SYBR Green PCR reagents (Takara). β-Actin was chosen as the reference gene transcript, and the relative expression ratio of the target gene compared with the reference gene was calculated as described previously37 . Each standard and sample was run simultaneously in duplicate on the same PCR plate, and the average of each duplicate value expressed as the number of copies was used for the statistical analysis.
9
Intestinal Mucosal RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen) was used to extract the total RNA of intestinal mucosal scrapings following its manufacturer's instructions. The purity and content of RNA were determined spectrophotometrically (Beckman Coulter DU800; Beckman Coulter Inc.) (Liu, Zhang, Li, Yan, & Zhang, 2019b ). Then, the RNA samples met the requirements were reverse‐transcribed into complementary DNA with the PrimeScript RT reagent kit (Takara). RT‐PCR for quantification analysis of target genes was performed on the Opticon DNA Engine (Bio‐Rad) with SYBR Green PCR reagents (Takara). Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) (GenBank NM001206359) and β‐actin (GenBank DQ452569) were selected as the housekeeping gene. The primers of β‐actin, GAPDH, NF‐κB, MyD88, claudin‐1, ZO‐1, Occludin, Bax, and Bcl‐2 were synthesized commercially by Life Technologies Limited ( Table S2 ). The cycle profile consisted of denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 20 s, 63°C for 30 s, and 72°C for 60 s. The PCR products were then analyzed for homogeneity by melting curve analysis. The housekeeping genes did not vary between diets (p = .81) in duplicates. Each sample and standard were moved simultaneously in duplicate on the same PCR plate, and the average of each duplicate copy was used for statistical analysis.
10
Transcriptional Activity of Key Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genes trancriptional activity (H3, TP53 , CDKN1A , BCL-2 , BAX ) was evaluated by the real-time RT-QPCR method with OPTICON TM DNA Engine (MJ Research, Watertown, MA) and QuantTect® SYBR® Green RT-PCR Kit (Quiagen, Valencia, CA). Cells were exposed to compounds 5 and 8 at a concentration of 0.5 µg/ml for 24 h. The RNA extraction was made by using Quick-RNA™ Kit MiniPrep (ZYMO RESEARCH). Total RNA integrity was analysed in 1.2% agarose electrophoresis with added ethidium bromide compound. The quantity and purity of extracted total RNA were determined by using spectrophotometric analysis with HP845 (Hewlett Packard, Waldbronn, Germany) spectrophotometer. The statistical analysis was performed using the Statistica 8.0 software (StatSoft, Tulsa, OK). All values were expressed as means ± SE.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!