Pcdh ef1 mcs t2a puro

Manufactured by System Biosciences

Sourced in United States

The PCDH-EF1-MCS-T2A-Puro is a lentiviral expression vector that allows for the expression of a gene of interest under the control of the EF1 promoter. The vector contains a multiple cloning site (MCS) for the insertion of the gene of interest, as well as a T2A self-cleaving peptide and a puromycin resistance gene for selection of transduced cells.

Automatically generated - may contain errors

Lab products found in correlation

Opti mem, by Thermo Fisher Scientific (1 mentions) Polybrene, by Merck Group (1 mentions) Pires2 egfp, by Takara Bio (1 mentions) Plenticas9 blast, by Addgene (1 mentions) Pcdh ef1 mcs t2a copgfp expression plasmid, by System Biosciences (1 mentions) Annexin 5, by Thermo Fisher Scientific (1 mentions) Lenticrispr v2, by Addgene (1 mentions) Anti tubulin, by Cell Signaling Technology (1 mentions) Anti smad2 3, by BD (1 mentions) Growth factor reduced matrigel, by BD (1 mentions) Click it edu alexa fluor 488 imaging kit, by Thermo Fisher Scientific (1 mentions) Dual luciferase reporter assay system, by Promega (1 mentions) Anti flag m2, by Merck Group (1 mentions) Mab2079z, by Merck Group (1 mentions) P3tp lux, by Addgene (1 mentions) Anti p smad2, by Cell Signaling Technology (1 mentions) Anti parp, by Cell Signaling Technology (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions) Pb ef1 mcs ires neo, by System Biosciences (1 mentions)

Close spelling variants of this product

PCDH-CMV-MCS-EF1-copGFP-T2A-Puro (3 citations) PCDH-EF1-MCS-T2A-Puro (CD520A1, (2 citations) PCDH-EF1-MCS-BGH-PGK-GFP-T2A-Puro vector (2 citations) PCDH-CMV-MCS-EF1-GFP-T2A-Puro vector (2 citations) PCDH-MSCV-MCS-EF1-copGFP-T2A-Puro plasmid (2 citations) PCDH-EF1-MCS-T2A-Puro vector (2 citations) PCDH-EF1-MCS-pA-PGK-copGFP-T2A-Puro (2 citations) PCDH-EF1-MCS-(PGK-GFP-T2A-Puro) (1 citations)

11 protocols using pcdh ef1 mcs t2a puro

Cloning Collagen XIII from Mouse and Human

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse Collagen XIII (NM_007731.3) were amplified from constructs pCMV-SPORT6-COL13a1 (Transomic, BC034164), and cloned into pCDH-EF1-MCS-T2A-Puro (System Biosciences, CD520A-1) with the primers of
Forward: 5’ AATTGAATTCGCCACCATGGTGGCGGAGCGCACCCGC 3′;
Reverse: 5’ACTGGCGGCCGCCTTATCGTCGTCATCCTTGTAATCCTGCCCTCCAGGCCTGCTTCT3’.
Human Collagen XIII (NM_001130103.1) was amplified from an expression construct described by Dennis et al. [38 (link)], and cloned into FLAG-tagged pCDH-EF1-MCS-T2A-Puro with the primers of
Forward: 5’AATTGCTAGCGCCACCATGGTAGCGGAGCGCACCCAC 3′;
Reverse: 5’ACTGGAATTCCTTGTTCCAGCAGCCTTGGAC 3′.

Zhang H., Fredericks T., Xiong G., Qi Y., Rychahou P.G., Li J.D., Pihlajaniemi T., Xu W, & Xu R. (2018). Membrane associated collagen XIII promotes cancer metastasis and enhances anoikis resistance. Breast Cancer Research : BCR, 20, 116.

+ Open protocol

+ Expand

Lentiviral Vector Construction and Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

The lentiviral vector we used was derived from pcDH-EF1-MCS-T2A-puro (SBI). The T2A sequence was replaced with IRES sequence amplified from pIRES2 (Contech) to avoid any addition of extra amino acids to the gene coding sequence inserted in the multiple cloning site (MCS), and the resulted vector was termed as pcDH-EF1-MCS-IRES-puro. For EGFP labeling, EGFP gene was amplified from pEGFP-C1 (Contech) and cloned into the MCS of pcDH-EF1-MCS-IRES-puro to generate pcDH-EF1-EGFP-IRES-puro.
For lentivirus generation, 293T cells were seeded 24 h before transfection, which would reach 80% confluence in 10 cm dishes on the day of transfection. Transfection was performed using X-toremifene HP (Roche). Briefly, 10 µg expression vector, 4.5 µg pLP1, 3.5 µg pLP2 and 2.5 µg pVSVG were added into 1 mL opti-MEM (Gibco). Then, 60 µL of transfection regent was added into the mixture and was mixed well. Twenty minutes later, the transfection mixture was added into the culture medium of 293T cells. Then, 12–18 h later, the medium was changed into fresh medium. The supernatant was collected 48 h post transfection, passed through a 0.45 µm filter (Millipore), and then applied to INR1G9 cells with 8 µg/mL polybrene (Sigma). The infected cells were selected with 2 µg/mL puromycin 72 h later; or at this time point, green fluorescence was monitored under inverted fluorescent microscope (BX51, Olympus).

Wu S., Zhou J., Guo J., Hua Z., Li J, & Wang Z. (2018). Apatinib inhibits tumor growth and angiogenesis in PNET models. Endocrine Connections, 8(1), 8-19.

+ Open protocol

+ Expand

Optimized SARS-CoV-2 and MERS-CoV Spike Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The spike gene of SARS-CoV-2 (Wuhan-Hu-1 strain and B.1.351 strain) was codon-optimized and cloned into BamHI/EcoRI in pcDNA3.1(+) with C-terminal 19-aa deletion 3 to generate pcDNA-SARS2-S (Wang et al., 2020 (link)). The spike genes with D614G, N501Y-614G, E484K-N501Y-D614G mutants, were generated by site-directed point mutation (TransGen Biotech). The MERS-CoV S gene was codon-optimized and cloned into pcDNA3.1(+) (Wang et al., 2020 (link)). The MARV glycoprotein expression vector was a gift from Dr. Linqi Zhang (Tsinghua University).
Human FcγR genes CD16A (GenBank: NM_000569.8), CD32A (GenBank: NM_001136219.3), CD32B (GenBank: NM_001002273.3) and CD64A (GenBank: NM_000566.4) were synthesized and cloned into XbaI/BamHI sites in pLenti-Cas9-Blast (Addgene) to substitute the Cas9 gene, and pLenti-CD16A-Blast, pLenti-CD32A-Blast, pLenti-CD32B-Blast and pLenti-CD64A-Blast were obtained. Human FCER1G gene was synthesized and cloned into EcoRI/BamHI sites in pCDH-EF1-MCS-IRES-puro to generate pcDH-FCER1G-puro. The vector pCDH-EF1-MCS-IRES-puro was constructed based on pcDH-EF1-MCS-T2A-puro (SBI System Biosciences) by synthesizing IRES sequence according to pIRES2-EGFP (Clontech) followed by puromycin coding sequence and cloning into NotI/SalI sites.

Wang Z., Deng T., Zhang Y., Niu W., Nie Q., Yang S., Liu P., Pei P., Chen L., Li H, & Cao B. (2021). ACE2 can act as the secondary receptor in the FcγR-dependent ADE of SARS-CoV-2 infection. iScience, 25(1), 103720.

+ Open protocol

+ Expand

Generation and Expression of CD19-targeting TRuC

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD19-targeting TRuC variants were generated by tethering the FMC63 (AA 1–267, GenBank ID: HM852952.1) single-chain Fv (scFv) sequence to various TCR subunits via the flexible linker (GGGGS)x3 using gene synthesis. TCRα and β variable domain sequences were described by Yoshikai et al. and Lopez et al., respectively^{49 (link),50 (link)}. The constructs were cloned into the pCDH-EF1-MCS-T2A-copGFP expression plasmid from System Bioscience (SBI, Palo Alto, CA) using the XbaI and EcoRI restriction sites. TRuC expression was coupled with a GFP reporter gene (copGFP) via a 2A-like sequence (T2A). For the generation of target cell lines, full-length firefly luciferase or CD19 lacking the cytoplasmic domain were cloned into pCDH-EF1-MCS-T2A-Puro (SBI, Palo Alto, CA) using XbaI and EcoRI restriction sites.

Baeuerle P.A., Ding J., Patel E., Thorausch N., Horton H., Gierut J., Scarfo I., Choudhary R., Kiner O., Krishnamurthy J., Le B., Morath A., Baldeviano G.C., Quinn J., Tavares P., Wei Q., Weiler S., Maus M.V., Getts D., Schamel W.W, & Hofmeister R. (2019). Synthetic TRuC receptors engaging the complete T cell receptor for potent anti-tumor response. Nature Communications, 10, 2087.

+ Open protocol

+ Expand

Antibody Validation and Cell Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-flag M2 (Sigma, F1804, 1:1000 for WB, 1:500 for IF). Anti-human β1 integrins,active (Millipore, MAB2079Z, 1:500 for IF). Anti-human Collagen XIII α1 (R&D systems, AF6346, 1:200 for WB). Anti-smad2/3 (BD Transduction Laboratories, 610842, 1:1000 for WB). Anti-p-smad2 (cell signaling, 130D4, 1:1000 for WB). Anti-tubulin (Cell Signaling, 2148, 1:5000). Anti-Integrin β1 subunit (AIIB2) (DSHB, 528306, 80 μg/ml for block assay). Anti-rat IgG1 (Santa Cruz Biotechology, sc-3882, 1:1000). Anti-PARP (Cell Signaling, 9542, 1:1000). Bovine Collagen Solution, Type I (Advanced BioMatrix, 5005).
Dual-luciferase reporter assay system (Promega, E1960). Click-It EdU Alexa Fluor 488 Imaging kit (Invitrogen, C10337). Growth Factor Reduced BD Matrigel™ (BD Biosciences, 354230). Annexin V (Thermo, A13201). LentiCRISPR v2 (Addgene, 52961), pCDH-EF1-MCS-T2A-Puro (System Biosciences, CD520A-1), p3TP-lux (Addgene, 306281), pGL4.10 (Addgene, 66128).

+ Open protocol

+ Expand

Lentiviral Overexpression of TRF3 in hESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human TRF3 cDNA (RC211988, NM_199047, OriGene, USA) was cloned into pCDH-EF1-3×Flag-MCS-T2A-Puro, modified from pCDH-EF1-MCS-T2A-Puro (System Biosciences, CA, USA), and named as pCDH-EF1-3×Flag-TRF3-T2A-Puro. The plasmid was verified by Sanger sequencing, and the vector was served as negative control. The viral package was performed with HEK-293FT cells (cat no. R70007, Invitrogen, Carlsbad, CA, USA) after transfection of plasmids (pMDLg/pRRE, pRSV-Rev, pMD2.G, pCDH plasmid) with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. For the viral infection, TRF3^−/−-1 and TRF3^−/−-2 hESCs were infected with the lentiviruses (LV-vector and LV-CDH-EF1-TRF3-T2A-Puro, respectively) for 6 h, and then, the media were changed. Forty-eight hours post-transfection, infected cells were selected with puromycin (1 μg/ml) for 2 days to generate the TRF3 overexpression cell lines with TRF3^−/−-1 and TRF3^−/−-2 hESCs (TRF3^−/−-1+3Flag-TRF3 and TRF3^−/−-2+3Flag-TRF3) and negative control ones (TRF3^−/−-1+vector and TRF3^−/−-2+vector).

Liang H., Zhang P., Bai H.J., Huang J, & Yang H.T. (2020). TATA box-binding protein-related factor 3 drives the mesendoderm specification of human embryonic stem cells by globally interacting with the TATA box of key mesendodermal genes. Stem Cell Research & Therapy, 11, 196.

+ Open protocol

+ Expand

Cloning and Mutagenesis of Human USP48 and BRAF

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length wild-type cDNA of human USP48 and BRAF were cloned into the lentivirus expression vector pCDH-EF1-MCS-T2A-Puro (System Biosciences). The desired mutations in BRAF and USP48 cDNA were introduced using a QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used in the construction of cDNA expression plasmids and mutagenesis are listed in Supplementary Table 3.

Chen J., Jian X., Deng S., Ma Z., Shou X., Shen Y., Zhang Q., Song Z., Li Z., Peng H., Peng C., Chen M., Luo C., Zhao D., Ye Z., Shen M., Zhang Y., Zhou J., Fahira A., Wang Y., Li S., Zhang Z., Ye H., Li Y., Shen J., Chen H., Tang F., Yao Z., Shi Z., Chen C., Xie L., Wang Y., Fu C., Mao Y., Zhou L., Gao D., Yan H., Zhao Y., Huang C, & Shi Y. (2018). Identification of recurrent USP48 and BRAF mutations in Cushing’s disease. Nature Communications, 9, 3171.

+ Open protocol

+ Expand

Construction of AC133-specific CAR vector

Check if the same lab product or an alternative is used in the 5 most similar protocols

The complete nucleotide sequence of the AC133-specific CAR was designed according to a published ERBB2-specific CAR sequence [49 (link)]. We exchanged the single-chain antibody (scFv) in the construct with the AC133-specific scFv, which was derived from the anti-AC133.1 mAb (ATCC HB-12346). The AC133-specific CAR cDNA was synthesized by GenScript. The T2A plus Puro^R sequence was cut from pCDH-EF1-MCS-T2A-Puro (System Biosciences) and inserted together with the AC133-CAR into the piggyBac transposon vector PB-EF1-MCS-IRES-Neo (System Biosciences) to replace the MCS-IRES-neo part according to standard procedures.

Zhu X., Prasad S., Gaedicke S., Hettich M., Firat E, & Niedermann G. (2014). Patient-derived glioblastoma stem cells are killed by CD133-specific CAR T cells but induce the T cell aging marker CD57. Oncotarget, 6(1), 171-184.

+ Open protocol

+ Expand

Overexpression and Telomere Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

PcDNA3.0‐Flag‐hTERT, pcDNA3.0‐hTR, siPES1, siDKC1, and siNC were described previously.³⁶ Lentiviral vectors for Flag‐hTERT overexpression were obtained by inserting PCR‐amplified gene fragments into pCDH‐EF1‐MCS‐T2A‐Puro (System Biosciences).
Anti‐Flag M2 agarose (A2220) was obtained from Sigma‐Aldrich. The biotinylated telomeric DNA substrate Bio‐L‐18GGG was synthesized and purified by Biomed Biotech with the sequences [5′‐biotin‐CTAGACCTGTCATCA(TTAGGG)_3‐3′]. dNTPs, gel electrophoresis loading buffer, and ladder DNA were purchased from Sangon Biotech. D‐biotin (#B4639) was purchased from Sigma.

Wang R., Li J., Jin R., Ye Q., Cheng L, & Liu R. (2021). Nonradioactive direct telomerase activity detection using biotin‐labeled primers. Journal of Clinical Laboratory Analysis, 35(6), e23800.

+ Open protocol

+ Expand

Genetic engineering of hepatic transcription factors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Complementary DNA of the five hepatic transcription factors were amplified from human full-length TrueClones™ (Origene) and inserted into pCDH-EF1-MCS-T2A-Puro (System Biosciences) according to the user’s manual. c-MYC was cloned into an inducible system of Fu-tet-hOct4 (hOct4 was replaced by c-MYC).^{37 (link)} FUdeltaGW-rtTA was from Addgene. The oligonucleotides encoding p53 siRNA were 5′-TGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTGGAG TCTTTTTTC-3′ and 5′-TCGAGAAAAAAGACTCCAGTGGTAATCTACTCTCTT GAAGTAGATTACCACTGGAGTCA-3′. The oligonucleotides were ligated downstream of the U6 promoter in a Lenti-Lox3.7 (pLL3.7) vector.^{38 (link)} Lentivirus production and collection were described previously.^{38 (link)}

Xie B., Sun D., Du Y., Jia J., Sun S., Xu J., Liu Y., Xiang C., Chen S., Xie H., Wang Q., Li G., LYU X., Shen H., Li S., Wu M., Zhang X., Pu Y., Xiang K., Lai W., Du P., Yuan Z., Li C., Shi Y., Lu S, & Deng H. (2019). A two-step lineage reprogramming strategy to generate functionally competent human hepatocytes from fibroblasts. Cell Research, 29(9), 696-710.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!