Total RNA from approximately 1.2 × 106 cells was extracted with the RNeasy Mini Kit (Qiagen). cDNAs were prepared with the RETROscript™ Kit (Ambion® Life Technologies), according to the manufacturer's protocol. Real-time PCR was performed using the Brilliant II SYBR green super mix (Agilent) and primer sets specific for human or murine TNF-α, IL-β, MCP-1, and GAPDH and β-actin (Supplementary Table 1 ). Expression of cytokines was normalized to GAPDH or β-actin with the ΔCt Method and relative expression was calculated with non-pretreated and unstimulated cells as references. The assay was conducted in triplicate; means and standard deviations were calculated for each group.
Brilliant 2 sybr green super mix
Manufactured by Agilent Technologies
Sourced in United States
Brilliant II SYBR green super mix is a ready-to-use solution for real-time PCR experiments. It contains SYBR Green I dye, a DNA polymerase, and necessary PCR components.
Automatically generated - may contain errors
3 protocols using brilliant 2 sybr green super mix
1
Quantifying Cytokine Expression in Cells
2
Quantifying Cytokine Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from approximately 1.2 × 106 cells with the RNeasy Mini Kit (Qiagen, United States) and cDNA was prepared with the RETROscriptTM Kit (Ambion® Life Technologies, United States), as per the manufacturer’s instruction. Real-time PCR was conducted using the Brilliant II SYBR green super mix (Agilent, United States) and primer sets for human tumor necrosis factor (TNF; forward: AACATCCAACCTTCCCAAACG, reverse: CTCTTAAACCCCCGAATCCCAG) and GAPDH (forward: CAACAGCGACACCCACTCCT, reverse: CACCCTGTTGCTGTAGCCAAA). Expression of cytokines was normalized to GAPDH with the ΔCt method and relative expression was calculated relative to non-pretreated and unstimulated control cells. The assay was conducted in triplicate; means and standard deviations were calculated for each group.
3
Quantifying Cytokine Expression in Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!