PCSK9 Stealth siRNA duplexes (Life Technologies) targeting sequences: 5′‐GAC AUC AUU GGU GCC UCC AGC GAC U‐3′ and 5′‐AGU CGC UGG AGG CAC CAA UGA UGU C‐3′. Hepatocyte nuclear factor 1α (HNF1α) Stealth siRNA duplexes (Life Technologies) targeting sequences: 5′‐UCG AUA CCA CUG GCC UCA ATT‐3′ and 5′‐UUG AGG CCA GUG GUA UCG ATT‐3′. The stealth RNAi negative control Duplex (Life Technologies) were used as a control. RNAi were transfected into HepG2 cells using Lipofectamine TM RNAiMAX (Life Technologies) according to the manufacturer's protocol.
Stealth sirna duplexes
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
Stealth siRNA duplexes are a type of laboratory equipment used for gene silencing. They are designed to suppress the expression of specific target genes in a variety of cell types. The duplexes are composed of two complementary RNA strands that bind to and degrade the target mRNA, effectively reducing the production of the corresponding protein.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax, by Thermo Fisher Scientific (4 mentions)
Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Lipofectamine rnaimax transfection kit, by Thermo Fisher Scientific (1 mentions)
Rnaimax, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Lipofectamine, by Thermo Fisher Scientific (1 mentions)
Sr 1078, by Merck Group (1 mentions)
Vitd3, by Merck Group (1 mentions)
Brdu proliferation assay, by BD (1 mentions)
Amaxa nucleofector, by Lonza (1 mentions)
13 protocols using stealth sirna duplexes
1
PCSK9 and HNF1α Knockdown in HepG2 Cells
2
Silencing ROCK1 and ROCK2 in 3T3-L1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNAs were introduced in 3T3-L1 cells by transient transfection with a LipofectamineTMRNAiMAX reagent (Invitrogen). Cells were further incubated for 2 days to reach confluence and then used for the analysis of insulin signaling pathway or DMI treatment. The luciferase reporter control siRNA was purchased from Invitrogen. siRNA for murine ROCK1 and ROCK2 were synthesized as StealthTM siRNA duplexes (Invitrogen). The sequences used are as follows: ROCK1 S1, 5′-GCACGCCUAACUGACAAGCACCAAU-3′; ROCK1 S2, 5′-UCCAAGUCACAAGCAGACAAGGAUU-3′; ROCK2 S1, 5′-CCGGACCCAUGGAUCAGAGAUAAUU-3′; ROCK2 S2, 5′-GCAGGAAACUCAGAAGCGUUGUCUU-5′.
3
siRNA-mediated gene knockdown in mouse zygotes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zygotes were collected from superovulated B6D2F1/J females mated to B6D2F1/J males (Charles River, Lyon, France) at 20 h post-hCG (defined as Day 1), maintained in M2 media, and microinjected into the cytoplasm with siRNA duplexes (100 μM). Gene-specific StealthTM siRNA duplexes were purchased from Invitrogen and prepared as described [13 (link)]. Sequences are listed in Table S2 ; Stealth™ RNAi Negative Control Med GC (Life Technologies Corporation, Ref. 12935300, Carlsbad, CA, USA) was used as a control.
Texas Red detection was used to monitor siRNA microinjections. Degenerated embryos were removed both immediately after injection and 18 h after. The number of embryos and their developmental stage (e.g., number of cells) were evaluated daily. Images were captured using a Leica DFC360Fx camera adapted to a Leica M165FC stereomicroscope (Leica Microsystems AG, Heerbrugg, Switzerland) using Leica Application Suite 3.2.0 (Leica Microsystems Ltd., Heerbrugg, Switzerland). For subsequent gene expression analysis, embryos were harvested at the indicated morphology in TRIzol® (Life Technologies Corporation, Carlsbad, CA, USA), flash-frozen, and stored at −80 °C.
Texas Red detection was used to monitor siRNA microinjections. Degenerated embryos were removed both immediately after injection and 18 h after. The number of embryos and their developmental stage (e.g., number of cells) were evaluated daily. Images were captured using a Leica DFC360Fx camera adapted to a Leica M165FC stereomicroscope (Leica Microsystems AG, Heerbrugg, Switzerland) using Leica Application Suite 3.2.0 (Leica Microsystems Ltd., Heerbrugg, Switzerland). For subsequent gene expression analysis, embryos were harvested at the indicated morphology in TRIzol® (Life Technologies Corporation, Carlsbad, CA, USA), flash-frozen, and stored at −80 °C.
4
FABP7 Gene Silencing in U-251 MG Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiRNA-mediated gene knockdown was achieved by using Lipofectamine RNAiMAX transfection kit (Invitrogen). U-251 MG cells plated to 6-well plates and grown to 30-50% confluence were transfected with 10 nM Stealth siRNA duplexes (Invitrogen): FABP7HSS103516, FABP7HSS103517, FABP7HSS103518 and siRNA negative control medium GC. Knockdown efficiency was assessed 72 h post-transfection by western blotting and real-time PCR.
5
Lox-Specific siRNA Silencing in 3T3-L1 Adipocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lox-specific stealth siRNA duplexes (GCGGAUGUCAGAGACUAUGACCACA) were designed and synthesized by Invitrogen (Invitrogen, Carlsbad, CA). Stealth siRNA negative control duplexes had a similar GC content. Fully differentiated 3T3-L1 adipocytes (day 8) were transfected with siRNA duplexes using Lipofectamine RNAi MAX according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). For TNFα treatment, 20 ng/mL of purified recombinant TNFα (PeproTech) was added to the medium from day 9 through day 11.
6
Silencing ROCK1 and AMPK with siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The small interfering RNAs (siRNAs) for mouse Rho kinase 1 (ROCK1) and AMPK were synthesized as Stealth siRNA duplexes (Invitrogen). The siRNA of the negative control was purchased from Bioneer (Seoul, Korea). The siRNA was incubated with lipofectamine RNAiMAX reagent (Invitrogen) in 100 µL serum-free medium for 15 minutes. The siRNA-Lipofectamine RNAiMAX complex was then added to the cells in 400 µL of serum-containing medium and maintained for 1 day, and then the cells were treated with palmitate and metformin as described.
7
Knockdown of Atg5 and Lamp2A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNAs were acquired as follows: Medium GC content negative control (Invitrogen; 465372), Atg5 (Invitrogen; Atg5MSS247019, 44009549), and Lamp2A (cocktail of two custom-designed Stealth siRNA duplexes from Invitrogen; sequences: 5′-CAGCUCUGGGAGGAGUACUUAUUCU-3′ and 5′-CAAGCGCCAUCAUACUGGAUAUGAG-3′, complexed to the reverse complement antisense sequences). Transfections were performed using Lipofectamine RNAi MAX (Invitrogen; 56532), with transfections prepared in OptiMEM (Gibco; 31985–062), according to the manufacturer’s instructions.
8
CXCR4 and CXCR7 Knockdown Procedure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CXCR4 and CXCR7 were knocked down using specific small interfering RNAs (siRNA) as previously described. For the knockdown of them, Stealth siRNA duplexes (Invitrogen) were transfected into the cells. Two different duplexes as well as negative control were used for CXCR4 and CXCR7. Cells were transfected at 50–70% confluence using RNAi MAX (Invitrogen) to give a final siRNA concentration of 20 nmol/L and were harvested 48 h after transfection.
9
siRNA Duplexes for Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stealth siRNA Duplexes and the Stealth RNAi Negative Control Medium GC Duplex were purchased from Thermo Fischer Scientific. All siRNA sequences used in this study are listed in Supplementary Table S3 .
10
Silencing Nrf2 Expression in Rat Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two stealth siRNA duplexes targeting the rat Nrf2 mRNA (#1: 5'-UGG AGC AAG ACU UGG GCC ACU UAA A-3' ; #2: 5'-GGA AAC CUU ACU CUC CCA GUG AGU A-3' ) and the stealth RNAi-negative control siRNA (medium GC content) were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Cells were transfected with siRNA (5 nM) using Lipofectamine RNAiMax and Opti-MEM media (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s instructions. Data represent the results of three independent experiments, each of which was performed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!