Taq pwo expand high fidelity pcr system

mRNA was isolated from Angelonia petals using the µMACS mRNA Isolation Kit (Miltenyi Biotec, Germany). cDNA was prepared using the SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA) and the oligo(-dT) anchor primer GACCACGCGTATCGATGTCGAC(T)16V. Based on information available in the NCBI-GenBank, nucleotide or amino acid sequences of DFRs from other plants from the order Lamiales, were aligned (Accessions X15536; EU305680, Y09127, EF522156) and conserved regions in the N-terminal region adopting the Rossmann fold [28] (link) were used for the design of degenerated primers. The obtained cDNA fragments were isolated, ligated into the vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA) and transformed in E. coli strain TOP10 (Invitrogen, Carlsbad, CA). Fragments were sequenced by a commercial supplier (Microsynth Austria AG, Vienna, Austria) and sequences were used for the design of specific 5′- and 3′-primers for the amplification of the ends of the DFR by RACE techniques, using the SMART RACE cDNA amplification kit (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) according to the manufacturer's instructions. Proofreading amplification of the complete open reading frame was carried out using specific forward and reverse primers (Table S1) and the Taq/Pwo Expand High Fidelity PCR System (Roche, Mannheim, Germany).

mRNA was extracted from poinsettia bracts with the μMACS mRNA isolation Kit (Miltenyi Biotec, Germany). cDNA was synthesized using the SuperScript II Reverse Transcriptase (Invitrogen, USA) and the primer oligo-dT SMART (AAGCAGTGGTATCAACGCAGAGTAC(T₂₃)VN). Based on specific sequence information of F3′H fragments from an E. pulcherrima transcriptome study (Debener, unpublished), 5′-partial F3′H cDNA clones were isolated from the four poinsettia cultivars. The start codon was identified by alignment with the F3′H of the closely related species Jatropha curcas (Accession number XM_012224974). The 3′ end was identified by application of the 3′-RACE technique, using the SMARTer RACE 5′/3′ Kit (Clontech, Takara Bio Europe, France). Full size cDNA was amplified with the primer pair Ep_F3′H_full (Additional file 3: Table S3) using the Taq/Pwo Expand High Fidelity PCR System (Roche, Germany).

Heterologous expression of the F3’H cDNA clones, which encode membrane bound enzymes, was performed in the yeast Saccharomyces cerevisiae according to established procedures [21 (link)]. F3’H cDNA clones were amplified with the Taq/Pwo Expand High Fidelity PCR System (Roche, Germany), and ligated into the vector pYES2.1/V5-His-TOPO (Invitrogen, USA). Plasmids were isolated and the presence and sense orientation of the insert was confirmed by sequencing (Microsynth Austria AG, Austria). The vectors containing the F3′H cDNAs of the four cultivars were transformed into the yeast strain INVSc1 using the Sc. EasyComp Transformation Kit (Invitrogen, USA). Heterologous expression and preparation of protein fractions were carried out as described previously [21 (link)]. Protein fractions were shock frozen in liquid nitrogen and stored at − 80 °C.