The largest database of trusted experimental protocols

Heparin sodium salt

Manufactured by Thermo Fisher Scientific
Sourced in United States

Heparin sodium salt is a naturally occurring anticoagulant compound used in various laboratory applications. It functions as an inhibitor of blood clotting factors, preventing the formation of blood clots. Heparin sodium salt is commonly utilized in research and diagnostic settings to maintain blood samples in an anticoagulated state.

Automatically generated - may contain errors

6 protocols using heparin sodium salt

1

Electrophysiological Assessment of Cx36-KO Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cx36-KO mice and WT littermates of either sex, between the ages of 4 and 5 wk,
were pretreated with heparin sodium salt (6.2 mg/ml, i.p.; Alfa Aesar, Lancaster,
United Kingdom) before being deeply anesthetized with halothane. Working
heart–brain stem preparations (WHBPs) were surgically prepared as
previously described (10 (link), 11 (link)); briefly, after submerging the head and
thorax in ice-cold artificial (a)CSF, decerebration at the precollicular level was
followed by skinning; then the phrenic and sympathetic nerves were isolated and
the diaphragm, lungs, and surrounding organs removed. After removal to a recording
chamber, the descending aorta was cannulated and perfused retrogradely with
aCSF.
+ Open protocol
+ Expand
2

Evaluating TMS and RSV Cytotoxicity in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
TMS (purity > 98%; Cat#T1829) and RSV (purity > 98%; Cat#0071) were purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan) Low-glucose Dulbecco’s modified Eagle’s medium (DMEM) powder (Cat#31600034), Roswell Park Memorial Institute (RPMI) 1640 medium powder (Cat#31800022), fetal bovine serum (FBS; Cat#10270106), penicillin-streptomycin (10000 U/mL; Cat#15140122), and 0.5% trypsin-EDTA (10×; Cat#15400054) were obtained from Gibco (Carlsbad, CA, USA). Heparin sodium salt (Cat#A16198) was purchased from Alfa Aesar (Carlsbad, CA, USA). Thiazolyl blue tetrazolium bromide (MTT; Cat#M6494) and bovine serum album (BSA; Cat#A8022) were obtained from Sigma Aldrich (St Louis, MO, USA). Dihydroethidium (DHE; Cat#D11347) was purchased from Invitrogen (Carlsbad, CA, USA).
+ Open protocol
+ Expand
3

Cationic Polymer-Based miRNA Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols
The materials and reagents used were as follows: anti-miR21 oligonucleotides (a-miR21) and cyanine5 (Cy5)-tagged a-miR21 (sequences T*CAACCATCAGTCTGATAAGC*T*A and Cy5-T*CAACCATCAGTCTGATAAGC*T*A, Future Synthesis), heparin sodium salt (IU ≥ 100/mg, MW: 8–25 kDa, Alfa Aesar, Haverhill, MA, USA), (N,N-dimethylacrylamide (DMAM, Sigma Aldrich, St. Louis, MO, USA), [2-(acryloyloxy)ethyl]trimethylammonium chloride (ATC, Sigma Aldrich), N,N’-bis(acryloyl)cystamine (CBA, Alfa Aesar), lithium phenyl (2,4,6-trimethylbenzoyl)phosphinate (LAP, Carbosynth, Compton, UK), fluorescein O-acrylate (Sigma Aldrich), Span 80 (Sigma Aldrich), cyclohexane (Chempur, Karlsruhe, Germany), acetone (Chempur), dimethyl sulfoxide (DMSO, Fisher Bioreagents, Pittsburgh, PA, USA), and dialysis membrane (Spectrum™ Spectra/Por™ 2 RC Dialysis Membrane, MWCO: 100 kDa).
+ Open protocol
+ Expand
4

HUVEC Insulin Stimulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs were purchased from ATCC and were grown in MCDB-131-complete media overnight. HUVECs for basal condition collection were grown in growth media of M199, 20% FBS, 0.05 g heparin sodium salt (Cat#9041-08-1, Alfa Aesar), and 15 mg ECGS (Cat#02-102, Millipore Sigma). Cells were routinely cultured on 1% of gelatin-coated plates at 37°C at 5% CO2. For insulin stimulation (Cat#SLBW8931), cells were serum starved for at least 13 hr in 1% FBS (Atlanta Bio selected, Cat#S11110) or without FBS using endothelial cells growth basal medium (Lonza Cat#cc-3121) instead of MCDB-131-complete media. Insulin stimulation was used for the times indicated at 100 nM.
+ Open protocol
+ Expand
5

Epithelial-Mesenchymal Transition Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
QuantiTect primer assays for α-SMA, vimentin, S100A4, Snail, Slug, Twist and glyceraldehyde 3-phosphate dehydrogenase were from Qiagen (Valencia, CA, USA). E-cadherin monoclonal antibody for immunofluorescence studies), β-catenin polyclonal antibodies (for immunofluorescence studies) and α-SMA polyclonal antibodies were from AbCam (Cambridge, MA, USA). Alexa 488-conjugated goat anti-mouse and Alexa 594-conjugated goat anti-rabbit secondary antibodies were from Life Technologies (Carlsbad, CA, USA). E-cadherin monoclonal antibody (for immunoblotting studies), β-catenin monoclonal antibody (for immunoblotting studies) and horseradish peroxidase-conjugated goat anti-rabbit secondary antibodies were from Cell Signaling Technologies (Danvers, MA, USA). Horseradish peroxidase-linked goat anti-mouse secondary antibodies were from GE Healthcare (Pittsburgh, PA, USA). Col IV was from BD Biosciences (San Jose, CA, USA). Uncoated and Matrigel-coated Transwell plates and heparin sodium salt were from Fisher Scientific (Waltham, MA, USA).
+ Open protocol
+ Expand
6

Quantification of Alginate Sulfation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sulfate modification of alginate was confirmed via1H NMR as described.[21 (link)] Briefly, lyophilized alginate samples were dissolved in D2O at 3.33% (w/v) concentration and recorded using an 800 MHz Bruker Avance III NMR spectrometer. Alginate sulfate modification was further verified through 1,9-Dimethyl-Methylene Blue zinc chloride double salt (DMMB) assay.[22 (link)] The DMMB solution pH was reduced to 1.5 to eliminate false readings from the negatively charged alginate polymer. Sulfated alginate was compared via DMMB assay with a sample of decellularized ECM derived from human MSCs and commercially available heparin sodium salt (Fisher Scientific, Hampton, NH). ECM was decellularized as previously described, including treatment with a detergent solution and deoxyribonuclease.[23 ]
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!