Ochratoxin

All chemicals used in this study were of analytical grade. Ochratoxin was purchased from Sigma Chemical Co. (St. Luis, MO, USA). Asp. Awamori powder was kindly supplied by Prof. K. Hayashi, Department of Biochemical Science and Technology, Faculty of Agriculture, Kagoshima University, Kagoshima, Japan. The kits of aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein, albumin, urea, creatinine, malondialdehyde (MDA), catalase (CAT), and total antioxidant capacity (TAC) were obtained from Biodiagnostics Co. (Cairo, Egypt). While LDH kit was purchased from Randox Laboratories Ltd. (Crumlin, UK), and CK-MB was obtained from Stanbio™ (CK-NAC [UV-Rate] kit; Boerne, TX, USA).

Ochratoxin A stock solution was prepared by dissolving the solid commercial toxin (Sigma-Aldrich, USA) in MetOH (1 mg/ml). Appropriate aliquots of the stock solution were brought to dryness and reconstituted with ACN-water-acetic acid (99:99:2 v/v/v) to obtain standard solutions of OTA within the range 0.05–0.10 μg/ml. The standard of OTα was purchased from Biopure (Romer Labs Diagnostic GmbH, Austria) at a concentration of 10 μg/ml in ACN. Aliquots of the stock solution were brought to dryness and reconstituted with ACN-water-acetic acid (99:99:2, v/v/v) to obtain standard solutions of OTα from 0.01 to 0.10 μg/ml.

Gold(iii) chloride aflatoxin B1 (Afl B1), and ochratoxin were purchased from Sigma-Aldrich. Sodium citrate and sodium chloride were procured from Sisco Research Laboratories Pvt. Ltd. (SRL), India. The aptamer sequence of Afl B1 was GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA (5′ to 3′). The ssDNA oligonucleotides were synthesized by GCC biotech. Stock solutions (100 μM) of aptamers were dissolved in ultrapure water and stored at −20 °C. Whatman filter paper was purchased from GE healthcare, India. Trysulfonium hexaflurophosphate and propylene glycol monomethyl ether acetate (PGMEA) were procured from Sigma-Aldrich. All reagents were of analytical grade and used as received.