T4 polynucleotide kinase

VEGFq and MutVEGF sequences were radiolabeled using [γ-32P]-dATP with T4 polynucleotide kinase (Life Technologies) and incubated in DMEM medium with 10% FBS at 37°C or in the presence of A549 S100 (cytoplasmic) extract for 0–72 h. Cold VEGFq or MutVEGF were added to give a final ODN concentration of 10 μM. At each time point, an equal volume of formamide dye was added and samples were quick frozen (ethanol bath) and stored at -80°C. After heating in 98% formamide buffer at 65°C, ODNs were run on a 12% denaturing gel and analyzed by autoradiography.

DNA oligonucleotides and pIDTSMART vectors were purchased from Integrated DNA Technologies (IDT) (Coralville, IA, USA). [γ-³²P]ATP was obtained from PerkinElmer (Shelton, CT, USA). HIV-1 RT was purchased from Worthington (Lakewood, NJ, USA). T4 polynucleotide kinase, proteinase K, SUPERaseIN, and Gel Loading Buffer II were bought from Life Technologies (Foster City, CA, USA). E271 loading dye base was obtained from AMRESCO LLC (Solon, OH, USA). The Ambion MEGAshortscript T7 kit was purchased from Life Technologies. The sequences of the HIV-1 acceptor RNA and (−) SSDNA, as well as the TAR and Psi RNAs were derived from HIV-1 NL4-3 (GenBank Accession no. AF324493) [94 (link)]. The corresponding SIV NAs were derived from SIVmac239 (GenBank Accession no. M33262) [12 (link), 13 (link)], which was obtained from Dr. Ronald Desrosiers through the AIDS Reagent Program, Division of AIDS, NIAID, NIH.

Penicillin/streptomycin, HEPES, bovine albumin fraction V, dithiothreitol (DTT), glycerol, tris-HCl, glycine, glucose, PMSF, NP-40, paraformaldehyde, poli-L-lysine, mifepristone, magnesium chloride, sodium chloride, trypsin, and trypsin inhibitor were purchased from Sigma (St Louis, MO, USA); EDTA, sodium hydrogen carbonate, potassium dihydrogen phosphate, potassium chloride and disodium hydrogen phosphate were purchased from Merck (Rio de Janeiro, Brazil). Dulbecco’s modified eagle medium (DMEM), fetal bovine serum, TRIzol reagent, SuperScript III Reverse Transcriptase, Taq Polymerase, T4 polynucleotide kinase, and 6-diamidino-2-phenylindole (DAPI) were purchased from Life Technology (Calrsbad, CA, USA). Saponin and tween 20 were purchased from AMRESCO (Solon, OH, USA).

Vpx deletion and point mutants were constructed by PCR mutagenesis of SIVmac239 and SIVmac316 genomes using the following primer pairs:

SIVmac239 and SIVmac316 X-del, forward primer: GATCCCAGGGAGAGAATCCCACCTGGAAACAG and reverse primer: TTACATCGCTTACTACTTTCAGTGCTAAGTACTGTAGGCTTGG;

SIVmac239 and SIVmac316 X-Q76A, forward primer: AGGCTTTATTTATGCATTGCAAGAAAGGCTGTAGATGTCTAGGGGAAG and reverse primer: TTGCTATTAAACACAAGTATCTGTATTTTACATAGCTTGGTGACATCCC

SIVmac316 X-Q76S, forward primer: TCAAAGGCTTTATTTATGCATTGCAAGAAAG and reverse primer: TATTAAACACAAGTATCTGTATTTTACATAGCTTGG.

The X-Q76A/I32T double mutant was constructed by PCR mutagenesis of SIVmac316 X-Q76A using forward primer: CAAACAGAGAGGCGGTAAACCACCTAC and reverse primer: TCTCCTCTACTGTTCTGTTTAGCCATTCG.

PCR amplifications were performed using Platinum PFX DNA polymerase (LifeTechnologies), with the following PCR parameters: 1 cycle of 94 C for 2 min, 32 cycles of a denaturing step of 94°C for 15 s, an annealing step of 58°C for 30 s, and an extension step of 68°C for 20 min, followed by a final extension of 68 C for 7 min. Following amplification, the PCR product was gel purified, treated with T4 polynucleotide kinase (LifeTechnologies), and then blunt-end ligated to created circular full-length infectious clones.

Total RNA was extracted from 1 ml of plasma using the miRCURY RNA extraction kit for Biofluids (Exiqon) with a modified lysis step. Samples were lysed at 50 °C for 20 min with GITC-containing lysis buffer (provided in the kit) and 10 mg ml⁻¹ proteinase K in a 0.5% SDS solution (to a final SDS concentration of 0.005%). Following lysis, RNA extraction was performed according to manufacturer's protocol. Resultant RNA was treated with T4 polynucleotide kinase (NEB) and quantified using Quant-iT RiboGreen RNA Assay (Life Technologies) according to manufacturers' protocols.

For EMSA, oligonucleotides SpTEL_A, SpTEL-M1_A, SpTEL-M2_A, SpTEL-M3_A, HsTEL_A, HisBox_A, HisBoxMut_A, HisBoxFlank_A, HisBoxFlank3'_A, HisBoxFlank5'_A, HisBoxFlankPart_A, respectively (S1 Table), were radioactively labeled using T4 polynucleotide kinase (Life Technologies) and [γ³²P]ATP. The labeled oligonucleotides were then mixed with non-labeled complementary oligonucleotides (S1 Table) in a molar ratio 1:3. The mixtures were incubated at 95°C for 5 min and cooled slowly to room temperature to allow DNA annealing. The unincorporated [γ³²P]ATP was removed from the DNA by gel filtration using Probe Quant G-50 MicroColumns (GE Healthcare). Purified recombinant proteins at concentrations from 0.05 to 4.5 μM were mixed with the corresponding DNA substrate (15 nM) and incubated for 10 min at room temperature in 10 μl HNE (Teb1) or HNED (Taz1) buffer. Samples were electrophoretically separated in 5% (v/v) polyacrylamide gels in 0.5x TBE buffer (45 mM Tris-borate, 1 mM EDTA-NaOH pH 8.0). DNA and DNA-protein complexes were visualized after exposing the gels to storage phosphor screens (Kodak) for 24–72 hours using Personal molecular imager FX (BioRad).

In vitro transcribed RNAs were 5’ radiolabeled with ATP, [γ-³²P] (PerkinElmer) using T4 polynucleotide kinase (Invitrogen) and purified using denaturing PAGE as described³⁴ . Labeled RNAs were incubated 30 min on ice with proteins from 0 to 32 μM concentration in a final volume of 5 μL EMSA reaction buffer (25 mM HEPES pH 7.3, 150 mM NaCl, 4 mM MgCl₂, 10% glycerol, 1 mM DTT, 0.5 mg mL⁻¹ yeast tRNA (ThermoFisher), and 12 U RNaseOUT (ThermoFisher)). The reactions were mixed with 5x native gel loading dye (10 mM Tris pH 8.0, 50% glycerol, 0.001% bromophenol blue, 0.001% Xylene cyanol FF) and separated on 10% native gels run in 1x Tris-Glycine buffer at 4 °C. Gels were dried and imaged with phosphor imaging screens (Molecular Dynamics). Band intensities were quantified using Molecular Dynamics ImageQuaNT TL software (GE Healthcare). Prism5 (GraphPad) was used for graph fitting and equilibrium dissociation constant (K_D) calculation with one site-specific binding with Hill slope: $Y=\frac{B_{\max }\times X^h}{\left({K_D}^h+X^h\right)}$ where X is the protein concentration, Y is the fraction bound, B_max is the maximum specific binding, and h is the Hill slope. The input data are X and Y, and B_max, h, and K_D are obtained from the fitting procedure. All EMSA results were repeated at least three times.