Genomic DNA was purified from peripheral blood mononuclear cells using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA). Genomic DNA (10 ng/per sample) was used for library preparation, using the DNA prep with an enrichment protocol (Illumina, San Diego, CA, USA) and a custom targeted panel of the 17 congenital hypothyroidism-causative genes TG (NM_003235.4), TPO (NM_000547.5), DUOXA2 (NM_207581.3), DUOX2 (NM_014080.4), SLC5A5 (NM_000453.2), SLC16A2 (NM_006517.4), SLC26A4 (NM_000441.1), TSHR (NM_000369.2), GNAS1 (NM_000516.4), THRB (NM_000461.4), THRA (NM_003250.5), PAX8 (NM_003466.3), NKX2.1 (NM_001079668.2), NKX2.5 (NM_004387.3), FOXE1 (NM_004473.3), IYD (NM_001164694.1), and SECISBP2 (NM_024077.4) [41 (link)]. Next-generation sequencing was performed on the NextSeq 550 platform using the Mid Output kit v2.5 (Illumina). Sequencing coverage of 30x reads was considered to be the minimum requirement for a sequence variant to be considered. Sequence data were processed using custom bioinformatic software pipelines to align reads to the HG19 reference genome. All reported variants were explored using public databases, as well as literature searches. All variants were confirmed by Sanger sequencing on a capillary ABI 3500XL sequencer using the BigDye Terminator v3.1 Cycle Sequencing kit (Thermo-Fisher Scientific, Waltham, MA, USA).
Abi 3500xl sequencer
Manufactured by Thermo Fisher Scientific
Sourced in United States, Sweden
The ABI 3500xL sequencer is a genetic analysis instrument designed for high-throughput DNA sequencing. It utilizes capillary electrophoresis technology to separate and detect fluorescently labeled DNA fragments, enabling the determination of nucleotide sequences.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye 3.1 sequencing kit, by Thermo Fisher Scientific (5 mentions)
Variant reporter software, by Thermo Fisher Scientific (3 mentions)
Bigdye terminator version 3.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions)
Usb exosapit, by GE Healthcare (3 mentions)
Sequencher software, by Gene Codes (2 mentions)
Big dye terminator reaction mix, by Thermo Fisher Scientific (2 mentions)
Exosap it, by GE Healthcare (2 mentions)
Bigdye xterminator purification kit, by Thermo Fisher Scientific (2 mentions)
Mid output kit v2, by Illumina (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Wizard genomic dna purification kit, by Promega (1 mentions)
Nucleon bacc3 kit, by GE Healthcare (1 mentions)
Seqscape software v3, by Thermo Fisher Scientific (1 mentions)
Pgl3 enhancer vector, by Promega (1 mentions)
Kod plus dna polymerase, by Toyobo (1 mentions)
Hiseq 4000 sequencer, by Illumina (1 mentions)
Ptz57r t, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 kit, by Thermo Fisher Scientific (1 mentions)
Hot start taq enzyme, by Qiagen (1 mentions)
Qiaamp dna blood mini kit, by Qiagen (1 mentions)
24 protocols using abi 3500xl sequencer
1
Targeted panel sequencing for congenital hypothyroidism
2
Genetic Analysis of Adrenal Insufficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The study was conducted in accordance with the principles of the Declaration of Helsinki and was approved by the Local Ethics Committee of the Hospices Civils de Lyon. Written informed consent was provided by all parents of the patients enrolled in the study. Genomic DNA was extracted from EDTA-preserved whole blood using Nucleon BACC3 kit (GE healthcare, Chalfont Saint Giles, Buckinghamshire, UK). DNA was analyzed by Sanger sequencing or Massively Parallel sequencing (MPS).
For patients 1 and 2, as CLAH was suspected on clinical and biological data, STAR and CYP11A1 genes were immediately Sanger sequenced. For patients 3 and 4 who presented with glucocorticoid deficiency, MC2R and MRAP genes were first Sanger sequenced. DNA was further analyzed by MPS.
Sanger sequencing consisted of selective amplification of the exons and the exon-intron boundaries of the analyzed gene by PCR using specific primers (sequences available upon request), followed by conventional dideoxy sequencing on an ABI-3500XL sequencer (Thermofisher scientific, Watham, MA, USA) and compared to the human genome (GRCh37/hg19 assembly) using SeqScape® software v3 (Thermofisher scientific).
For MPS, a custom panel targeting 57 genes involved in adrenal insufficiency and DSD including the CYP11A1 gene as previously described (22 (link)) was used. Pathogenic mutations found by MPS were verified by Sanger sequencing.
For patients 1 and 2, as CLAH was suspected on clinical and biological data, STAR and CYP11A1 genes were immediately Sanger sequenced. For patients 3 and 4 who presented with glucocorticoid deficiency, MC2R and MRAP genes were first Sanger sequenced. DNA was further analyzed by MPS.
Sanger sequencing consisted of selective amplification of the exons and the exon-intron boundaries of the analyzed gene by PCR using specific primers (sequences available upon request), followed by conventional dideoxy sequencing on an ABI-3500XL sequencer (Thermofisher scientific, Watham, MA, USA) and compared to the human genome (GRCh37/hg19 assembly) using SeqScape® software v3 (Thermofisher scientific).
For MPS, a custom panel targeting 57 genes involved in adrenal insufficiency and DSD including the CYP11A1 gene as previously described (22 (link)) was used. Pathogenic mutations found by MPS were verified by Sanger sequencing.
3
Cloning and Characterization of Human EGR4 Transcriptional Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The entire coding sequence of human EGR4 (NM_001965) was amplified by PCR using KOD plus DNA polymerase (Toyobo, Osaka, Japan). The PCR product was inserted into the EcoRI and XhoI sites of the pCAGGSn3FH vector which contains an N-terminal FLAG tag. For luciferase reporter plasmids, DNA fragments from the 5′-flanking regions of PTHrP-V3 and V4 (NM_198964.1 and NM_198966.1, respectively), SAMD5 (NM_001030060.2), RAB15 (NM_198686.2), SYNPO (NM_007286.5) and DLX5 (NM_005221.5), which include potential EGR binding sites as predicted by the MatInspector program (Genomatix, http://www.genomatix.de/matinspector.html ), were amplified by PCR and inserted into the appropriate restriction enzyme sites in the pGL3-enhancer vector (Promega, Madison, WI, USA). The PCR primer sets used in this study are shown in Table S1 . The DNA sequences of all constructs were confirmed by DNA sequencing (ABI 3500xL sequencer; Life Technologies, Foster City, CA, USA).
4
Whole-exome sequencing for genetic variant identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-exome sequencing on DNA of the patient II.5 and both parents was performed using the Agilent SureSelectXT Human All Exon V7 enrichment kit on an Illumina HiSeq 4000 sequencer. The “Varbank 2” pipeline of the Cologne Center for Genomics (CCG) was used to analyze the exome data using the following filter criteria: coverage of > 6 reads, quality score of > 10, allele frequency ≥ 25%, and a minor allele frequency (MAF) < 0.1% in the gnomAD (https://gnomad.broadinstitute.org ) database. The following databases were used to obtain gene information: National Center for Biotechnology Information (NCBI; https://www.ncbi.nlm.nih.gov ), Ensembl Genome Server (http://www.ensembl.org ), UCSC Genome Bioinformatics (http://genome-euro.ucsc.edu ) and Genome Aggregation Database (gnomAD; http://gnomad.broadinstitute.org ). The variant identified by whole-exom sequencing was amplified from DNA of the index patient and PCR products were sequenced by BigDye Terminator method on an ABI 3500XL sequencer (Life Technologies, Germany). The identified mutation was re-sequenced in an independent experiment and tested for co-segregation within the family.
5
Complete Dengue Virus Genome Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The complete genome sequences for each DENV serotype were obtained as previously described [15] (link). To avoid redundancy in methodology, only essential aspects are described. The entire Open Reading Frames were completed using the GS 454 platform [18] (link) and the 5′ and 3′ untranslated regions (UTR) were amplified using a specific set of primers (see Table S1 ), cloned into the TOPO TA cloning plasmidial-bacterial system (Invitrogen, Carlsbad, CA, USA), and then sequenced in both directions using the plasmid M13F/M13R primers, the ABI Prism BigDye Terminator v3.1 Sequencing Kit (Life Technologies, Foster City, CA, USA), and the ABI 3500 XL sequencer (Life Technologies, Foster City, 92 CA, USA).
6
Amplification and Sequencing of LysM Receptor Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from plant leaf pools was isolated by AxioPrep kit (Axigen) and was used as the template DNA for PCR amplifications. Approximately 0.9 kb DNA fragments encoding all three LysM domains of the plant receptor gene, NFR5, were amplified with the following pairs of primers: forward “NFR5‐for4” (5′AAGTCTTGGTTGTTACTTGCC‐3′) and reverse “NFR5‐Grev3” (5′‐CACCTGAAAGTAACTTATCYGCA‐3′) for V. sativa; forward “NFR5‐for4” and reverse “NFR5‐Grev3” (5′‐TGCAGTCTCAGCTAATGAAGTAC‐3′) for L. pratensis; forward “NFR5‐for4” and reverse “NFR5‐Grev6” (5′‐CATACATTGTTGGCTTGCTTAC‐3′) for T. hybridum. The standard PCR protocol was used: initial denaturation at 95°C for 3 min, 30 cycles with denaturation at 94°C for 30 s, primer annealing at 48°C for 30 s, extension at 72°C for 1 min, and final extension for 4 min. PCR fragments were extracted from agarose gel (Onishchuk, Chizhevskaya, Kurchak, Andronov, & Simarov, 2015 ) and cloned into the plasmid pTZ57R/T (Thermo Scientific). For each plant species, 100 randomly selected cloned fragments of NFR5 genes were sequenced by Sanger method in an automated ABI 3500xL sequencer (Applied Biosystems) using standard M13 (−20) and (−26) primers. Sequences were deposited in the GenBank database under the Pool accession number 1041522217. The multiple alignment of 100 sequences was performed with ClustalW as implemented in MEGA6 (Tamura et al., 2013 ).
7
Genetic Polymorphism and BRCA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the polymorphism analysis, DNA was extracted using the QIAamp Blood DNA Mini-Kit (Qiagen) according to the manufacturer's instructions. Genotyping was performed through PCR amplification using the Hot Start Taq enzyme (Qiagen). Following amplification, the products were purified with the ExoSap enzyme (USB products) and sequenced bidirectionally using the BigDye Terminator v3.1 Kit (Applied Biosystems, USA). Electrophoresis was run in the automated sequencer model 3500 (Applied Biosystems, USA).
For the analysis of mutations in the BRCA1 and BRCA2 genes and the subsequent separation of the participants into the three study groups, a multiplex PCR amplification of all coding exons of the BRCA1 (NCBI; NM_007294.3) and BRCA2 (NCBI; NM_000059.3) genes and their respective flanking intronic regions was performed, followed by bidirectional sequencing using two platforms (ABI 3500 XL sequencer) and a new generation sequencer (Ion Torrent PGM, Applied Biosystems). In addition, large rearrangements were investigated using the multiplex ligation-dependent probe amplification (MLPA) technique.
For the analysis of mutations in the BRCA1 and BRCA2 genes and the subsequent separation of the participants into the three study groups, a multiplex PCR amplification of all coding exons of the BRCA1 (NCBI; NM_007294.3) and BRCA2 (NCBI; NM_000059.3) genes and their respective flanking intronic regions was performed, followed by bidirectional sequencing using two platforms (ABI 3500 XL sequencer) and a new generation sequencer (Ion Torrent PGM, Applied Biosystems). In addition, large rearrangements were investigated using the multiplex ligation-dependent probe amplification (MLPA) technique.
8
APOE Exon 4 Sequencing from Whole Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from whole-blood samples was isolated using standard methods. Exon 4 of the APOE gene was amplified by polymerase chain reaction and purified by ExoSap-IT (USB), as previously described [32 (link)]. Amplified fragments were sequenced by the Sanger method using the BigDye 3.1 sequencing kit (Applied Biosystems, Waltham, MA, USA) in an automated ABI 3500xL sequencer (Applied Biosystems). DNA sequences were analyzed using Variant Reporter software (Applied Biosystems).
9
HFE Gene Sequencing from Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood was drawn using the BD Vacutainers System® (Becton Dickinson, NJ, USA) for blood cell count and genetic analysis. Genomic DNA was isolated from peripheral blood leukocytes by a salting-out method. Coding sequences of the HFE exons 2 and 4 were amplified by polymerase chain reaction (PCR) using the previously described primer sequences [19 ]. PCR products were purified using ExoSAP-IT® reagent (GE Healthcare, NJ, USA) and were bidirectionally sequenced using the ABI Terminator Sequencing Kit according to the manufacturer’s instructions and an ABI 3500XL Sequencer® (Applied Biosystems, Foster City, CA, USA).
10
Fungal ITS Region Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted using NucleoSpin® 96 well plant II vacuum processing (Macherey-Nagel) Kit, for fungi according to manufacturer’s protocol. The ITS region was amplified via PCR using ReadyMix™ Taq PCR Reaction Mix (Sigma) with the primers ITS2-S2F (5’-ATGCGATACTTGGTGTGAAT-3’ ) and ITS4 (5’-CCTCCGCTTATTGATATGC-3’ ). A subset of samples not yielding ITS2-S2F/ITS4 amplicons were amplified using the primer pairs ITS8-F (5’-AGTCGTAACAAGGTTTCCGTAGGTG-3’ ) and ITS6-R (5’-TTCCCGCTTCACTCGCAGT-3’ ) [18 (link)] and ITS1 (5’-3’ ) and ITS4 (5’-CCTCCGCTTATTGATATGC-3’ ) [24 (link)–25 ]. PCR reaction mixtures were prepared in 20 μL volumes including 10 μL (2X) ready mix (Sigma–Aldrich), 1μL each primer (10pM), 50 ng/ μL template DNA, 1.2 μL MgCl2 (25 mM), and sterile MilliQ water to reach 20 μL total. Amplification conditions were as follows: 95°C for 5 minutes, 35 cycles of 95°C for 30 seconds, 56°C for 45 seconds, 72°C for 1.5 minutes and 72°C for 10 minutes. PCR products were purified using GenElute PCR purification kit (Sigma Life science). Sequencing reactions were conducted using BigDye v3.1 dye terminator chemistry with the primer pairs ITS2-S2F/ITS4, ITS1/ITS4 and ITS8F/ITS6R and analyzed using ABI 3500XL sequencer (Applied Biosystems).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!