To identify potential non-invasive biomarkers from the characterization of the intestinal microbiome in various stages of CD, LEfSe (Linear Discriminant Analysis Effect Size) was used22 (link). In addition, the absolute quantification of Faecalibacterium prausnitzii, Escherichia coli, and the total bacteria species present was studied using the QX200 Droplet Digital PCR system (ddPCR; Bio-Rad Laboratories), following the ddPCR Multiplex Supermix (BIORAD) kit protocol5 (link),23 (link)–26 (link). For this, the appropriate primers and probes were selected to perform a triplex PCR together with the optimization of their concentrations and thermal programs5 (link),23 (link)–26 (link). The QuantaSoft program version 1.7.4 was used to export the recorded amplitude data. The Faecalibacterium prausnitzii/Escherichia coli (F/E) ratio analysis was normalized using the following equation ([log10 (copies/µL F. prausnitzii) – log10 (copies/µL E. coli)] / [log10 (copies/µL ARNr 16S])27 (link).
Qx200 droplet digital pcr ddpcr system
Manufactured by Bio-Rad
Sourced in United States
The QX200 droplet digital PCR (ddPCR) system is a digital PCR platform designed for high-precision gene expression analysis and absolute quantification of nucleic acids. The system partitions a sample into thousands of nanoliter-sized droplets, allowing for the detection and quantification of target sequences with exceptional sensitivity and precision.
Automatically generated - may contain errors
Lab products found in correlation
Qx200 droplet generator, by Bio-Rad (11 mentions)
Qx200 droplet reader, by Bio-Rad (9 mentions)
Quantasoft software, by Bio-Rad (6 mentions)
C1000 touch thermal cycler, by Bio-Rad (4 mentions)
Droplet generator, by Bio-Rad (4 mentions)
Qx200 ddpcr evagreen supermix, by Bio-Rad (4 mentions)
Ddpcr supermix for probe, by Bio-Rad (4 mentions)
Quantasoft v 1, by Bio-Rad (4 mentions)
Qiaamp viral rna mini kit, by Qiagen (3 mentions)
Px1 pcr plate sealer, by Bio-Rad (3 mentions)
Droplet reader, by Bio-Rad (3 mentions)
Dg8 cartridge, by Bio-Rad (3 mentions)
Ddpcr supermix for probes no dutp, by Bio-Rad (3 mentions)
Evagreen supermix, by Bio-Rad (2 mentions)
Quantasoft analysis software, by Bio-Rad (2 mentions)
Dnase, by Thermo Fisher Scientific (2 mentions)
Quantasoft software version, by Bio-Rad (2 mentions)
1xone step rt ddpcr mix for probes, by Bio-Rad (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Cfx connect real time system machine, by Bio-Rad (2 mentions)
59 protocols using qx200 droplet digital pcr ddpcr system
1
Intestinal Microbiome Characterization for Crohn's Disease Biomarkers
2
SARS-CoV-2 Quantification via ddPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 280 ul of nasopharyngeal swabs using QIAamp viral RNA mini kit (Qiagen) following manufacturer’s instruction. SARS-CoV-2 genomic RNA was quantified by means of the QX200™ Droplet Digital™ PCR System (ddPCR, Biorad) using an home-made protocol targeting the RNA dependent RNA polymerase (RdRp) of SARS-CoV-2 (Forward: 5’- GACTTTGTGAATGAGTTTTACGC-3’ , Reverse: 5’- AGCCACTAGACCTTGAGATGC-3’ and FAM Probe: 5’- CACACAACAGCATCGTCAGA-3’ ) and the housekeeping gene RNAse P [15 ] HEX (Forward: 5’- AGATTTGGACCTGCGAGCG-3’ , Reverse: 5’- GAGCGGCTGTCTCCACAAGT -3’ and HEX Probe: 5’- TTCTGACCTGAAGGCTCTGCGCG-3’ ). The cycling conditions were: 45°C (60 min), 95°C (10 min), 40 cycles of 95°C (30 sec) and 58°C (1 min), 98°C (10 min), 4°C (∞). SARS-CoV-2 quantification was finally expressed in number copies/mL of swab.
3
Droplet Digital PCR Analysis of CmdsRNase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression levels of CmdsRNase were detected using a QX200 Droplet Digital PCR system (ddPCR) (Bio-Rad, Hercules, CA, USA) at different developmental stages and in various adult tissues. The disposable eight-channel DG8 cartridge was placed in the cartridge holder, and 20 μL of PCR mixtures were transferred to the middle wells of the cartridge. The lower wells were filled with 70 μL of droplet-generation oil. The cartridge containing the PCR mixtures and oil was placed into a Droplet Generator (Bio-Rad, Hercules, CA, USA) to generate individual droplets. Then, 40 μL of droplets were transferred into wells of a 96-well PCR plate, which was heat-sealed at 180 °C for 5 s with a permeable foil using a PX1 PCR Plate Sealer and loaded into a C1000 Touch Thermal Cycler (Bio-Rad, Hercules, CA, USA). The PCR reaction system and conditions are listed in Table 1 . After PCR was complete, the sealed plate was placed into a Droplet Reader (Bio-Rad, Hercules, CA, USA) to count the positive and negative droplets. The ddPCR experiment was repeatedly performed three times for each sample. Data were analyzed using QuantaSoft software (Bio-Rad, Hercules, CA, USA) and SPSS 22.0 (SPSS Inc., Chicago, IL, USA).
4
Quantification of pks+ E. coli in Tumor Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We determined the absolute pks+E. coli copy number of DNA exacted from tumor tissue and normal mucosal tissue using the QX200 Droplet Digital PCR System (ddPCR, Bio‐Rad Laboratories, Hercules, California, USA) according to the manufacturer's protocols. The PCR reaction was performed in a 20‐μL volume containing 10 ng of genomic DNA, 10 μL 2X EvaGreen Supermix (Bio‐Rad Laboratories), and 250 nmol/L of each primer. Primer sequences for pks+E. coli were as follows: forward primer, 5′‐GCGCATCCTCAAGAGTAAATA‐3′; reverse primer 5′‐GCGCTCTATGCTCATCAACC‐3′.
17 (link) Droplet generation was performed using a QX200 Droplet Generator (Bio‐Rad Laboratories). PCR conditions were 7 min at 95°C, 35 cycles of 30s at 95°C, 30s at 55°C, and 30s at 72°C, with a final extension for 7 min at 72°C. The 96‐well plate was transferred to the QX200 droplet reader (Bio‐Rad Laboratories), and data were analyzed with Quanta Software version 1.7.4 (Bio‐Rad Laboratories).
17 (link) Droplet generation was performed using a QX200 Droplet Generator (Bio‐Rad Laboratories). PCR conditions were 7 min at 95°C, 35 cycles of 30s at 95°C, 30s at 55°C, and 30s at 72°C, with a final extension for 7 min at 72°C. The 96‐well plate was transferred to the QX200 droplet reader (Bio‐Rad Laboratories), and data were analyzed with Quanta Software version 1.7.4 (Bio‐Rad Laboratories).
5
Quantifying HIV-1 DNA in Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A QX200 Droplet Digital PCR System (ddPCR, Bio-Rad) was used for the quantification of total HIV-1 DNA in type-1 macrophages. Total DNA was extracted from a pellet of cells 4 days post-infection, in both treated and untreated HIV-1 infected macrophages and for negative control in non-infected macrophages, by using the Allprep® DNA/RNA mini kit (Qiagen, Germany) according to the instruction of the manufacturer. Total HIV-DNA was quantified by ddPCR using a home-made assay, targeting the 5’-LTR of HIV-1 (28 (link)). DNA copies were normalized to cell number according to the quantification obtained from the Albumin-based ddPCR copy number assay: Alb, Human (Bio-Rad, Pleasanton, California, USA) and, thus, reported as HIV-DNA copies/3 × 105 cells (29 (link)).
6
Quantification of SARS-CoV-2 Viral Load
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 280 ul of respiratory samples or plasma samples using QIAamp viral RNA mini kit (Qiagen) following manufacturer’s instruction. SARS-CoV-2 genomic RNA was quantified by means of the QX200™ Droplet Digital™ PCR System (ddPCR, Biorad) using an home-made protocol targeting the RNA dependent RNA polymerase (RdRp) of SARS-CoV-2 and the housekeeping gene RNAse P [14 , 15 ]. All results were further confirmed by using a second assay adapted for ddPCR and targeting two different portions of RdRp (https://www.who.int/docs/default-source/coronaviruse/real-time-rt-pcr-assays-for-the-detection-of-sars-cov-2-institut-pasteur-paris.pdf?sfvrsn=3662fcb6_2 ). SARS-CoV-2 quantification was finally expressed in number copies/mL.
7
SARS-CoV-2 RNA Detection in Breastmilk
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The presence of SARS-CoV-2 RNA in breastmilk samples was defined by quantifying genomic RNA and subgenomic RNA using a QX200 Droplet Digital PCR System (ddPCR; Bio-Rad). Total RNA was extracted from breastmilk samples (400 μL) using a QIAamp viral RNA minikit (Qiagen) by following the manufacturer’s instructions. The SARS-CoV-2 genomic RNA was quantified as previously published.28 (link) The SARS-CoV-2 subgenomic RNA was quantified using assays adapted for the ddPRC system and targeting the envelope transcripts, nucleocapsid transcripts, and spike transcripts.29 (link) Molecular detection of SARS-CoV-2 in breastmilk samples from 7 mothers who tested negative for SARS-CoV-2 infection (controls) was also evaluated.
8
Quantitative Assessment of RNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNeasy Plus Micro kit (Qiagen, catalog no. 74034) as per the manufacturer's protocol, subsequently used to generate cDNA with LunaScript RT SuperMix Kit. Probe-based ddPCR was performed on QX200 Droplet Digital PCR System (ddPCR; Bio-Rad Laboratories) following manufacturer's protocol. Absolute quantity of DNA per sample (copies/μL) was processed using QuantaSoft (v.1.0.596) and converted to copies/CEC according to amount of input sample. Please refer to Supplemental Table S6 for primer sequences.
9
Transduction of Adipose-Derived Stem Cells with TSTA Vector
10
Quantification of Toll-like Receptor Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RAW264.7 were cultured, supplemented, and stimulated as described above. Gene expression was analyzed using the QX200 Droplet Digital PCR (ddPCR) system from Bio-Rad (Munich, Germany) according to the manufacturer’s instructions. Total RNA was extracted using the InviTrap Spin Universal RNA Mini Kit (Stratec Biomedical, Birkenfeld, Germany). Complementary DNA was synthesized using the qScript cDNA SuperMix (Quanta BioSciences, Gaithersburg, MD, USA). Gene expression of TLR1, TLR2, and TLR6 was analyzed by quantitative real-time PCR using the ddPCR EvaGreen Supermix (Bio-Rad, Munich, Germany). Primer sequences and thermal cycling conditions used can be found in Table 1 . Negative controls, i.e., no template control, and no reverse transcriptase control, were performed for each run. ddPCR data were analyzed using QuantaSoft analysis software (Bio-Rad, Munich, Germany), and the quantification of the target molecule was presented as the number of copies per µg total RNA used. Measurements were performed in triplicates and are representatives of three independent experiments for each combination of fatty acid and stimulant.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!