To ligate Illumina DIY adapters (as in Section 2.3.6 , described above), end-repair and A-tailing reactions were carried out in the same microtube but at a lower temperature. The following reagents were mixed in a new microtube: 10 μL of cleaned amplicons from 1st PCR, 5 μL of ligase buffer (B302 Sybenzyme), 5 μL of adapter mix, 0.5 μL of T4 DNA ligase (E330 Sybenzyme, Novosibirsk, Russia), 0.5 μL of 5′ deadenylase (M0331 NEB, Ipswich, MA, USA), 1 μL of 10 mM ATP (R0441 ThermoFisher, Waltham, MA, USA), 1 μL of Klenow exo- (m0212L NEB, Ipswich, MA, USA), 1 μL of dATP (R0141 ThermoFisher, Waltham, MA, USA), 2 μL of T4 PNK (EK0032 ThermoFisher, Waltham, MA, USA), 12 μL of 50% PEG-8000 solution, and 12 μL of MQ water. The mix was incubated at 37 °C for 40 min: 10 °C for 10 s, 30 °C for 30 s (100 cycles).
Klenow exo
Manufactured by New England Biolabs
Sourced in United States
Klenow exo- is a DNA polymerase enzyme derived from the Klenow fragment of DNA polymerase I. It has 5'→3' DNA polymerase activity but lacks 3'→5' exonuclease activity.
Automatically generated - may contain errors
Lab products found in correlation
Ampure xp bead, by Beckman Coulter (4 mentions)
Dynabeads oligo dt 25, by Thermo Fisher Scientific (3 mentions)
End it repair kit, by Illumina (3 mentions)
Hiseq 2500 platform, by Illumina (2 mentions)
Genome analyzer iix, by Illumina (2 mentions)
Qiaprep spin column, by Qiagen (2 mentions)
Pb buffer, by Qiagen (2 mentions)
Nebuffer 2, by New England Biolabs (2 mentions)
Ez dna methylation gold kit, by Zymo Research (2 mentions)
T4 rapid dna ligase, by Qiagen (2 mentions)
Q5 dna polymerase, by New England Biolabs (2 mentions)
Dynabeads m 280 streptavidin, by Thermo Fisher Scientific (2 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (2 mentions)
5 deadenylase, by New England Biolabs (1 mentions)
R0441, by Thermo Fisher Scientific (1 mentions)
Hexanucleotide mix, by Merck Group (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Ligafast, by Promega (1 mentions)
Phusion dna polymerase, by New England Biolabs (1 mentions)
Scriptseq index pcr primers, by Illumina (1 mentions)
20 protocols using klenow exo
1
Illumina DIY Adapter Ligation Protocol
2
Transposon-Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tn-seq library preparation and sequencing were performed according to Goodman et al.48 (link). Briefly, DNA was isolated from the obtained samples with 300 µL of Cica Genius DNA Extraction Solution (Kanto Chemical, Tokyo, Japan) and the transposon-flanking region was amplified by a liner PCR using primer BioSamA (Supplementary Data 10 ). The PCR products were purified using a QIA Quick PCR Purification Kit (Qiagen, Hilden, Germany) and bound to Dynabeads M-280 Streptavidin (Invitrogen, Carlsbad, CA, USA) before double-stranded by Klenow (exo-) (New England Biolabs, Ipswich, MA, USA) and hexanucleotide mix (Sigma Aldrich, St. Louis, MO, USA). The DNA was then digested with MmeI (New England Biolabs), ligated with barcoded adapters, and amplified with primers LIB-PCR3 and LIB-PCR5 (Supplementary Data 10 ). Finally, PCR products with ~125 bp in size were sequenced on an Illumina Hiseq 2500 platform (Illumina, San Diego, CA, USA) in 50-bp single-read mode.
3
ChIP-seq and RIP-seq Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Libraries for ChIP-seq were prepared according to manufacturer's instructions (Illumina, San Diego, CA) and as described (Asp et al., 2011 (link)). Briefly, IP'ed DNA (∼5 ng) was end-repaired using End-It Repair Kit (Epicenter, Madison, WI), tailed with deoxyadenine using Klenow exo− (New England Biolabs), and ligated to custom adapters with LigaFast (Promega). Fragments of 300 ± 50 bp were size-selected and subjected to ligation-mediated PCR amplification using Phusion DNA polymerase (New England Biolabs). Libraries were quantified by qPCR using primers annealing to the adapter sequence and sequenced at a concentration of 7 pM on an Illumina Genome Analyzer IIx or 10 pM on an Illumina HiSeq. In some cases barcoding was utilized for multiplexing.
For RIP-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo(dT)25 (Invitrogen) beads and constructed into strand-specific libraries using the dUTP method (Parkhomchuk et al., 2009 (link)). Once dUTP-marked double-stranded cDNA was obtained, the remaining library construction steps followed the same protocol as described above for ChIP-seq libraries.
For RIP-seq libraries, polyA+ RNA was isolated using Dynabeads Oligo(dT)25 (Invitrogen) beads and constructed into strand-specific libraries using the dUTP method (Parkhomchuk et al., 2009 (link)). Once dUTP-marked double-stranded cDNA was obtained, the remaining library construction steps followed the same protocol as described above for ChIP-seq libraries.
4
Fragmented DNA Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all samples, we started with 100–300 ng of double-stranded, fragmented DNA. We end-repaired and 5′-phosphorylated using the End Repair Module (New England Biolabs #E6050L), A-tailed with Klenow exo- (New England Biolabs #M0212S), and ligated to adapters (8.3 nM) with a Quick Ligase Kit (New England Biolabs #M2200S). We PCR-amplified using Phusion 2X HF master mix (New England Biolabs #M0531S) in a 50-μl total volume containing 200 nM of each primer. Thermocycler conditions were as follows: an initial denaturation at 98° for 30 sec; no more than 12 cycles of 98° for 30 sec, 65° for 30 sec, and 72° for 30 sec; and a final extension at 72° for 5 min. We purified DNA between each enzymatic treatment using Agencourt AMPure XP at a ratio of 1.8:1, except after PCR, where the ratio was 0.9:1. Prior to sequencing, we selected amplicons corresponding ∼150-bp inserts by gel electrophoresis on a 2.5% agarose gel and purified using a QIAquick gel extraction kit (Qiagen #28704). We used indexed PCR primers from the ScriptSeq Index PCR primers (Epicentre, #RSBC10948 and #SSIP1202) at a concentration of 200 nM. We used a Y adapter of the following two oligos at a concentration of 8.3 nM each: /5Phos/GATCGGAAGAGCACACGTCT and ACACTCTTTCCCTACACGACGCTCTTCCGATCT.
5
Replication Profiling of orc1-161 Mutant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
G1 arrested cells were filtered on a 0.45-mm nitrocellulose membrane, washed twice with YPD, and released into half the volume of prewarmed YPD containing BrdU (800 µg/mL) for 33 min at 24° C. For replication profiling of the orc1-161 mutant in HU, cells were released into YPD containing BrdU and 200 mM HU at room temperature for 60 min. G1 and S phase cells were harvested by adding a 0.1% final concentration of sodium azide. Genomic DNA was prepared, and BrdU-labeled DNA was immunoprecipitated as previously described (Viggiani et al. 2010 (link)). To ensure conversion of ssDNA to dsDNA before library prep, 10 ng of DNA was denatured for 5 min at 95°C and incubated with 0.17U Klenow exo- (NEB), 1.2 mM dNTPs, and 1 ng/µL random hexamers (Invitrogen) for 10 min at 22°C and for 30 min at 37°C for a total of two cycles.
6
Preparation of Cy3-Labeled dsDNA Substrates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences of 80-nt unlabeled strands are listed in the Supplementary Sequences and were ordered as PAGE-purified oligonucleotides from IDT. The 25-nt Cy3-labeled primer listed in the Supplementary Sequences is complementary to the 3′ end of each 80-nt substrate. This primer was ordered as an HPLC-purified oligonucleotide from IDT. To generate the Cy3-labeled dsDNA substrates, the 80-nt strands (5 μL of a 100 μM solution) were combined with the Cy3-labeled primer (5 μL of a 100 μM solution) in NEBuffer 2 (38.25 μL of a 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.9 solution, New England Biolabs) with dNTPs (0.75 μL of a 100 mM solution) and heated to 95 °C for 5 min, followed by a gradual cooling to 45 °C at a rate of 0.1 °C/s. After this annealing period, Klenow exo– (5 U, New England Biolabs) was added and the reaction was incubated at 37 °C for 1 h. The solution was diluted with Buffer PB (250 μL, Qiagen) and isopropanol (50 μL) and purified on a QIAprep spin column (Qiagen), eluting with 50 μL of Tris buffer.
7
Preparation of Cy3-Labeled dsDNA Substrates
8
Whole-Genome Bisulfite Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA methylation analysis with WGBS was performed using 100–500 ng of genomic DNA, isolated with the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) with some modifications: samples were incubated for 4 h at 56 °C with an additional RNAse A incubation for 30 min at 37 °C. Following this, 500 ng of genomic DNA spiked with 4% (w/w) unmethylated lambda phage DNA (Thermo Fisher Waltham, MA, USA was sheared to a mean length of 200 bp using the Covaris S220 focused-ultrasonicator. Libraries for WGBS were prepared as follows: DNA fragments were end-repaired using the End-It kit (Epicentre, Madison, WI, USA), A-tailed with Klenow exo- (NEB, Ipswich, MA, USA), and ligated to methylated Illumina TruSeq adapters (BIOO Scientific, Austin, TX, USA) with DNA Ligase (NEB), which was followed by bisulfite conversion using the EZ DNA-methylation Gold kit (Zymo Research, Irvine, CA, USA). Library fragments were then subjected to 7 cycles of PCR amplification with KAPA HiFi Uracil+ DNA polymerase (KAPA Biosystems, Wilmington, MA, USA). Sequencing was performed either with single-end 100 bp on a HiSeq 1500 or a MiSeq (Illumina, San Diego, CA, USA) or paired-end 2 × 150 bp on a NovaSeq 6000 (Illumina, San DIego, CA, USA).
9
Hi-C Chromatin Conformation Capture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ten million cells were cross-linked with 1% formaldehyde for 10 min at room temperature. Nuclei were permeabilized. DNA was digested with DpnII (NEB), and the ends of restriction fragments were labeled using biotin-14-dATP (Life Technologies) and then ligated in a small volume. After reversal of crosslinks, ligated DNA was purified and sheared to a length of roughly 400 base pairs by sonication (Covaris S220), at which point ligation junctions were pulled down with MyOne Streptavidin C1 Dynabeads (Life Technologies) and prepared for Illumina sequencing. Isolated DNA was end-repaired before dATP-tailing with Klenow exo-(NEB), and they were ligated to Illumina paired-end sequencing adapters. Bead-bound Hi-C DNA was amplified with 11–13 rounds of PCR amplification. The final library was sequenced on an Illumina HiSeq X Ten sequencer with pair-end 150 bp reads.
10
Single-Cell DNA Methylation Profiling by PBAT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The single-cell methylation was constructed by the post-bisulfite adaptor tagging (PBAT) method [15 (link),16 (link),17 (link),18 (link)]. Briefly, the isolated DNA was incubated in protease mix (1× Tris-EDTA, 20 mM KCl, 0.3% Triton-X 100, 1 mg/mL protease, 10 ng carrier RNA, 1/100 lambda DNA) at 50 °C for 3 h, 75 °C for 30 min. The bisulfite conversion was conducted as the instruction of the EZ DNA Methylation Kit (ZYMO Research, Irvine, CA, USA). The 6N-oligo1 (biotin-CTACACGACGCTCTTCCGATCTNNNNNN) was ligated to DNA fragments by Klenow exo–(NEB, Ipswich, MA, USA). The extra primer was removed by exo-I (NEB, USA), then the DNA was purified using 0.8× AMPure XP beads (Beckman Coulter Life Sciences, USA). The biotin-labeled DNA fragment was isolated by Dynabeads M280 Streptavidin (Thermo Fisher Scientific, USA), then the second strand was synthesized by Klenow exo–. The library was amplified by 13 cycles of PCR. The library was purified by 0.8× AMPure XP beads twice and sequenced by the Illumina platform.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!