Total RNA was prepared using the E.Z.N.A. Total RNA Kit I (Omega Bio-Tek Inc, R6834). 400 ng of RNA was reverse transcribed into cDNA using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs®, E6560L). For one real-time reaction, 5 µL of Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Scientific), with 100 ng of the synthesized cDNA plus an appropriate random primer mix, were analyzed on a C1000 Touch Thermal Cycler CFX96 Real-Time System (Bio-Rad). The comparative Ct method was used to determine the relative mRNA expression of genes normalized by the housekeeping gene GAPDH. The primer sequences: mouse Gapdh, forward primer 5‘- gcggcacgtcagatcca -3‘, reverse primer 5‘- catggccttccgtgttccta -3‘; mouse Ifnb1, forward primer 5‘- cagctccaagaaaggacgaac -3‘, reverse primer 5‘- ggcagtgtaactcttctgcat -3‘; mouse Cxcl10 (IP10), forward primer 5‘- ccaagtgctgccgtcattttc -3‘, reverse primer 5‘- ggctcgcagggatgatttcaa -3‘; mouse Ccl5 (RANTES), forward primer 5‘- gctgctttgcctacctctcc -3‘, reverse primer 5‘-tcgagtgacaaacacgactgc-3‘; GFP, forward primer 5‘- aagggcatcgacttcaagg -3‘, reverse primer 5‘- tgcttgtcggccatgatatag -3‘; HSV-1 VP16, forward primer 5‘- ggactgtattccagcttcac -3‘, reverse primer 5‘- cgtcctcgccgtctaagtg -3‘.
Maxima sybr green rox qpcr master mix 2
Manufactured by Thermo Fisher Scientific
Sourced in United States
Maxima SYBR Green/ROX qPCR Master Mix (2×) is a ready-to-use solution for quantitative real-time PCR (qPCR) reactions. It contains Maxima Hot Start Taq DNA Polymerase, SYBR Green I dye, and optimized buffer components.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (14 mentions)
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (5 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (4 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Dnase 1, by Thermo Fisher Scientific (3 mentions)
Quantstudio 6 flex, by Thermo Fisher Scientific (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Genelute bacterial genomic dna kit, by Merck Group (2 mentions)
Maxima first strand cdna synthesis kit for rt qpcr, by Thermo Fisher Scientific (2 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time system c1000 touch thermal cycler, by Bio-Rad (1 mentions)
Protoscript 2 first strand cdna synthesis kit, by New England Biolabs (1 mentions)
E z n a, by Omega Bio-Tek (1 mentions)
Total rna kit 1, by Omega Bio-Tek (1 mentions)
7500 fast dx real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500, by Thermo Fisher Scientific (1 mentions)
Iscript reverse transcription supermix for qrt pcr, by Bio-Rad (1 mentions)
56 protocols using maxima sybr green rox qpcr master mix 2
1
Quantitative RT-PCR Analysis of Immune Gene Expression
2
Species-specific qPCR Validation for Mildew
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR validation of species-specific primers was performed using a 7500 Fast Dx real-time PCR instrument with SDS software (Applied Biosystems, USA). The reaction mix contained 12.5 µl of Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Scientific, USA) 400 nM of each primer, 20 ng of DNA template of each mildew isolate and nuclease-free water to reach a final volume of 25 µl. No template controls (NTC) were systematically included in triplicate. The thermal cycling conditions comprised an initial denaturation step of 7 min at 95 °C for 30 s and annealing at 60 °C for the 30 s. A melt curve analysis using a temperature gradient from 60 °C to 100 °C and a ramp speed of 0.5 °C/s and continuous fluorescent measurement was performed after the last cycle.
Species-specific qPCR assay performed, DNA isolated from pure cultures of both the mildew isolates CsKP07 and CsKD11, used as the positive control. Reactions containing DNA from healthy cucurbit plants and NTC reactions were used as negative controls. All qPCR assays were performed in triplicate. The expected size of both the mildew pathogens was confirmed by gel electrophoresis, as described above.
Species-specific qPCR assay performed, DNA isolated from pure cultures of both the mildew isolates CsKP07 and CsKD11, used as the positive control. Reactions containing DNA from healthy cucurbit plants and NTC reactions were used as negative controls. All qPCR assays were performed in triplicate. The expected size of both the mildew pathogens was confirmed by gel electrophoresis, as described above.
3
Real-Time qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time qPCR analysis was carried out on ABI Prism 7500 (Applied Biosystems, California, USA) using Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Scientific, Massachusetts, USA). The primer sequences are showed in Table 1 .
4
Gene Expression Analysis of Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from isolated cells (splenocytes, sorted cells) and cerebral cortices (bregma + 2 to − 3 mm) using Tri reagent (MRC, OH). cDNA was synthetized with iScript reverse transcription supermix for qRT-PCR (Bio-Rad). qRT-PCR was conducted with cDNA in duplicate reactions using the Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Scientific). The reactions were performed in 20-μl total volume and incubated at 50 °C for 2 min and then at 95 °C for 10 min followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. All samples were run in triplicate. The relative mRNA level of each gene was normalized to that of the housekeeping gene GAPDH. The sequences of the primers used are shown in Table 1 .
Sequences of PCR primers used in this study
| Gene | Forward | Reverse |
|---|---|---|
| CD147 | 5′-GACACTGGGGAAGAAGAGGC-3′ | 5′-GCAGTGAGATGGTTTCCCGA-3′ |
| TNF-α | 5′-AGTCCGGGCAGGTCTACTTT-3′ | 5′-ACCCTGAGCCATAATCCCCT-3′ |
| IL-1β | 5′-ATGCCACCTTTTGACAGTGATG-3′ | 5′-GCAGCCCTTCATCTTTTGGG-3′ |
| IL-6 | 5′-CCTTCCAGGATGAGGACATGA-3′ | 5′-TGAGTCACAGAGGATGGGCTC-3′ |
| Arg1 | 5′-TCACCTGAGCTTTGATGTCG-3′ | 5′- CTGAAAGGAGCCCTGTCTTG-3′ |
| MCP-1 | 5′-CCCCAAGAAGGAATGGGTCC-3′ | 5′-GTGCTGAAGACCTTAGGGCA-3′ |
| Ly6C | 5′-ACTGTGCCTGCAACCTTGT-3′ | 5′-GCTGGGCAGGAAGTCTCAAT-3′ |
| CCR2 | 5′-ATCCACGGCATACTATCAACATC-3′ | 5′-CAAGGCTCACCATCATCGTAG-3′ |
| iNOS | 5′-CAAGCACCTTGGAAGAGGAG-3′ | 5′- AAGGCCAAACACAGCATACC-3′ |
| GAPDH | 5′-GCGAGATCCCGCTAACATCA-3′ | 5′-CTCGTGGTTCACACCCATCA-3′ |
5
Olfactory Mucosa RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from olfactory mucosa using TRIzol (Life Technologies) followed by DNase I digestion, according to the manufacturers' protocols. cDNA was generated using the RETROscript Reverse Transcription Kit (Thermo Fisher Scientific) with Oligo dTs. Primer sequences can be found in Supplementary Table 1 . qPCR was performed on a StepOnePlus Real-Time PCR system (Applied Biosystems) using Maxima SYBR green/ROX qPCR Master Mix × 2 (Thermo Fisher Scientific). All reactions were performed in triplicate; Ct values were averaged for each gene in each sample. Results were analysed by the 2 −ΔΔCt method69 (link) with normalization to the geometric mean of Actb, Gapdh and Ubc70 (link). For details, see Supplementary Methods .
6
16S rRNA Gene Quantification from Blood
7
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from siliques and developing seeds using the CTAB-LiCl method (Jaakola et al., 2001 (link)). Isolated RNA samples were treated with DNaseI (Thermo Fisher Scientific), and 1 μg of RNA was used to prepare cDNA from each sample using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). qRT-PCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Fisher Scientific) and the Applied Biosystems 7900-HT Fast Real-Time detection system. For amplification, a standard two-step thermal cycling profile was used (15 s at 95°C and 1 min at 60°C) for 40 cycles, after a 10-min preheating step at 95°C. Samples were run in triplicates, and UBC18 was used as the internal reference gene. Data analysis was carried out using either the 2-ΔCT or the 2-ΔΔCT method. The Student's t-test was used to determine the significance of differences between groups. Data are presented as mean±s.d.
8
RNA Isolation and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was
isolated from cells using the TRIzol reagent (15596-026,
Thermo Fisher Scientific, Massachusetts, USA), according to the manufacturer’s
instructions. RNA was reverse transcribed to complementary DNA (cDNA)
using RevertAid Reverse Transcriptase (EP0441, Thermo Fisher Scientific,
Massachusetts, USA). The real-time PCR method is described elsewhere.58 (link) In short, cDNA samples were diluted 1:25 and
analyzed using Maxima SYBR Green/ROX qPCR Master Mix (2×) (K0221,
Thermo Fisher Scientific, Massachusetts, USA) in a CFX96 Touch real-time
PCR detection system (Bio-Rad Laboratories, California, USA) for their
specific mRNA content using the following primer sequences purchased
from Eurofins Genomics: human β-actin: fwd (5′-GGA TGC
AGA AGG AGA TCA CTG-3′), rev (5′-CGA TCC ACA CGG AGT
ACT TG-3′); human IDO: fwd (5′-GTC ATG GAG ATG TCC GTA
AG-3′), rev (5′-CTT GGA GAG TTG GCA GTA AG-3′);
murine β-actin: fwd (5′-ATG GAG GGG AAT ACA GCC-3′),
rev (5′-TTC TTT GCA GCT CCT TCG TT-3′); murine IDO transcript
1: fwd (5′-ATG TTG GCT TTG CTC TAC CA-3′), rev (5′-GAC
CAC CTC AGG GTT TAG CG-3′).
isolated from cells using the TRIzol reagent (15596-026,
Thermo Fisher Scientific, Massachusetts, USA), according to the manufacturer’s
instructions. RNA was reverse transcribed to complementary DNA (cDNA)
using RevertAid Reverse Transcriptase (EP0441, Thermo Fisher Scientific,
Massachusetts, USA). The real-time PCR method is described elsewhere.58 (link) In short, cDNA samples were diluted 1:25 and
analyzed using Maxima SYBR Green/ROX qPCR Master Mix (2×) (K0221,
Thermo Fisher Scientific, Massachusetts, USA) in a CFX96 Touch real-time
PCR detection system (Bio-Rad Laboratories, California, USA) for their
specific mRNA content using the following primer sequences purchased
from Eurofins Genomics: human β-actin: fwd (5′-GGA TGC
AGA AGG AGA TCA CTG-3′), rev (5′-CGA TCC ACA CGG AGT
ACT TG-3′); human IDO: fwd (5′-GTC ATG GAG ATG TCC GTA
AG-3′), rev (5′-CTT GGA GAG TTG GCA GTA AG-3′);
murine β-actin: fwd (5′-ATG GAG GGG AAT ACA GCC-3′),
rev (5′-TTC TTT GCA GCT CCT TCG TT-3′); murine IDO transcript
1: fwd (5′-ATG TTG GCT TTG CTC TAC CA-3′), rev (5′-GAC
CAC CTC AGG GTT TAG CG-3′).
9
Quantitative PCR analysis of tagged Salmonella
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from enriched cultures was extracted using the GenElute Bacterial Genomic DNA kit (catalog no. NA2110-1KT; Sigma). qPCR analysis with Maxima SYBR Green/ROX qPCR Master Mix (2×) (catalog no. K0222; Thermo Fisher Scientific) on a OneStepPlus instrument (Thermo Fisher Scientific) was performed using 9 ng of gDNA and tag-specific primers (Table S1 and Fig. S1A ) based on reference 36 (link). The relative abundance of each strain was normalized to the abundance in the inoculum. Standard curves were generated using gDNA from each tagged S.Tmwt strain (Fig. S2 ).
10
Exosomal miRNA-122 Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Exosome and total RNA, including miRNA, were extracted using Total RNA Extraction Kit (INtRON Biotechnology, Seongnam-si, Gyeonggi-do, South Korea). cDNA synthesis and targeted real-time quantitative PCR (qPCR) for miRNA-122 were conducted using Maxima SYBR Green/Rox qPCR master mix 2× (Thermo Fisher Scientific, Waltham, MA, USA) and miRNA-specific primers.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!