Stepone plus real time pcr system and software

Manufactured by Thermo Fisher Scientific

Sourced in United States

The StepOne Plus Real Time PCR system is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It is capable of performing real-time PCR experiments and data analysis. The system includes the necessary hardware and software components to facilitate the amplification, detection, and quantification of nucleic acid sequences.

Automatically generated - may contain errors

Lab products found in correlation

Agilent 2100 bioanalyzer, by Agilent Technologies (7 mentions) Mesa fast qpcr, by Eurogentec (6 mentions) Agilent rna 6000 nano kit, by Agilent Technologies (6 mentions) Reverse transcription system kit, by Promega (6 mentions) Tripure reagent, by Roche (6 mentions) Qiacube, by Qiagen (4 mentions) Nanodrop, by Thermo Fisher Scientific (4 mentions) Omni bead ruptor, by Omni International (3 mentions) Rneasy mini kit, by Qiagen (2 mentions) Quant it rna assay kit, by Thermo Fisher Scientific (2 mentions) Omni bead ruptor and 2.8 mm ceramic beads, by Omni International (2 mentions) Qscript reverse transcription kit, by Quantabio (2 mentions) Perfecta sybr mix, by Quantabio (2 mentions) Iscript reverse transcription kit, by Bio-Rad (2 mentions) 2.8 mm ceramic beads, by Omni International (2 mentions) Taqman fluorogenic detection system, by Thermo Fisher Scientific (1 mentions) Validated primers, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) 7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Tri reagent, by Merck Group (1 mentions)

Close spelling variants of this product

StepOne (326 citations) StepOne system (296 citations) StepOne software (286 citations) StepOne Real-Time PCR (74 citations) StepOne PCR system (70 citations) Real-Time System (23 citations) StepOne Plus Real-Time PCR software (6 citations) StepOne Plus™ system software (6 citations) StepOne real-time PCR software (4 citations) PLUSTM (3 citations)

20 protocols using stepone plus real time pcr system and software

Genotyping of gne gene by PCR and TaqMan

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping of gne was done either by PCR (2 reactions per sample), using the gne 28F and 427R primers and an additional allele-specific primer (see primer sequences, Supplementary Table S1), or a TaqMan real-time PCR reaction (#4444557, Thermo-fisher, US) with two gne allele-specific probes, based on the 4 bp deletion in exon 3, that differ by sequence and by the fluorophore wavelength (WT “JOE”, and mutant “FAM”). Annealing temperature was optimized to 60.5°C in a two-step real-time qPCR reaction (StepOnePlus™ Real-Time PCR System and software, Applied Biosystems, Thermo-fisher, US).

Livne H., Avital T., Ruppo S., Harazi A., Mitrani-Rosenbaum S, & Daya A. (2022). Generation and characterization of a novel gne Knockout Model in Zebrafish. Frontiers in Cell and Developmental Biology, 10, 976111.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis in Mouse Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using TRI reagent (Sigma). Quantification and integrity analysis of total RNA was performed by running 1 μl of each sample on an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). RNA was purified using an RNeasy Mini Kit (Qiagen) and reverse transcribed using a high-capacity cDNA reverse transcription kit (Life technologies). Gene expression of POMC, NPY, AgRP, Pax4, Pax6, Foxa1, and Foxa2 was quantified using 7900HT Fast Real-Time PCR System and TaqMan fluorogenic detection system (Applied Biosystems). Validated primers were purchased from Applied Biosystems. Comparative real-time PCR was performed in triplicate and data was analyzed according to the 2^−ΔCT method normalized to 18S.
Real-time PCRs of ZO1 and Occludin were performed with the StepOnePlus™ real-time PCR system and software (Applied Biosystems) using Mesa Fast qPCR™ (Eurogentec) for detection according to the manufacturer's instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were run in duplicate and data were analyzed according to the 2^−ΔCT method. The identity and purity of the amplified product was checked through analysis of the melting curve carried out at the end of amplification. Primer sequences for the targeted mouse genes are presented.

Brooks L., Viardot A., Tsakmaki A., Stolarczyk E., Howard J.K., Cani P.D., Everard A., Sleeth M.L., Psichas A., Anastasovskaj J., Bell J.D., Bell-Anderson K., Mackay C.R., Ghatei M.A., Bloom S.R., Frost G, & Bewick G.A. (2016). Fermentable carbohydrate stimulates FFAR2-dependent colonic PYY cell expansion to increase satiety. Molecular Metabolism, 6(1), 48-60.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analysing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega, Leiden, The Netherlands). Real-time PCR was performed with the StepOnePlus™ real-time PCR system and software (Applied Biosystems, Den Ijssel, The Netherlands) using Mesa Fast qPCR™ (Eurogentec, Seraing, Belgium) for detection according to the manufacturer’s instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2^−ΔΔCT method. The identity and purity of the amplified product was assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table 4.

Everard A., Geurts L., Caesar R., Van Hul M., Matamoros S., Duparc T., Denis R.G., Cochez P., Pierard F., Castel J., Bindels L.B., Plovier H., Robine S., Muccioli G.G., Renauld J.C., Dumoutier L., Delzenne N.M., Luquet S., Bäckhed F, & Cani P.D. (2014). Intestinal epithelial MyD88 is a sensor switching host metabolism towards obesity according to nutritional status. Nature Communications, 5, 5648.

+ Open protocol

+ Expand

Comprehensive RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using an OMNI Bead Ruptor and 2.8-mm ceramic beads (OMNI International) followed by Qiashredder and an RNeasy kit (the right lobe of liver, terminal ileum, and cells), RNeasy Fibrous Tissue Mini Kit (for gastrocnemius muscle), and an RNeasy Lipid Tissue Mini Kit (for epididymal fat) using Qiacube (Qiagen) automated extraction according to the manufacturer’s specifications with DNase treatment (RNase-Free DNase Set; Qiagen). Total RNA was quantified using Quant-iT RNA Assay Kit (Thermo Fisher Scientific). Complementary DNA was prepared using qScript reverse transcription kit (QuantaBio). qPCR was performed using the Perfecta SYBR Green Fastmix mix (Quantabio) and the StepOne Plus Real Time PCR system and software (Applied Biosystems).
The primers used are listed in Table 1.

Li Z., Gurung M., Rodrigues R.R., Padiadpu J., Newman N.K., Manes N.P., Pederson J.W., Greer R.L., Vasquez-Perez S., You H., Hioki K.A., Moulton Z., Fel A., De Nardo D., Dzutsev A.K., Nita-Lazar A., Trinchieri G., Shulzhenko N, & Morgun A. (2022). Microbiota and adipocyte mitochondrial damage in type 2 diabetes are linked by Mmp12+ macrophages. The Journal of Experimental Medicine, 219(7), e20220017.

+ Open protocol

+ Expand

Quantitative Analysis of Alistipes onderdonkii

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from fecal samples using QIAamp Fast DNA Stool Mini Kit according to the manufacturer’s protocol. qPCR was performed using Perfecta SYBR mix (Quantabio) and StepOne Plus Real Time PCR system and software (Applied Biosystems). Primers used to specifically to detect Alistipes onderdonkii DSM19147 were: Forward, GAG AGC AAT GAA CTG CAC GA; Reverse, GGC ACG ACG GGA TAG TAG AA. Primers used to detect 16S ribosomal RNA gene were: Forward, AGA GTT TGA TCC TGG CTC AG; Reverse, TGC TGC CTC CCG TAG GAG T. The relative abundance of Alistipes was normalized to total bacterial load (16S).

González-García M., García I., Ding L., O'Shea S., Boise L.H., Thompson C.B, & Núñez G. (1995). bcl-x is expressed in embryonic and postnatal neural tissues and functions to prevent neuronal cell death.. Proceedings of the National Academy of Sciences of the United States of America, 92(10), 4304-4308.

+ Open protocol

+ Expand

RNA Extraction and Real-time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analysing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega, Leiden, The Netherlands). Real-time PCR was performed with the StepOnePlus™ real-time PCR system and software (Applied Biosystems, Den Ijssel, The Netherlands) using Mesa Fast qPCR™ (Eurogentec, Seraing, Belgium) for detection according to the manufacturer’s instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2^-ΔCT method. The identity and purity of the amplified product was assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table S4.

Everard A., Lazarevic V., Gaïa N., Johansson M., Ståhlman M., Backhed F., Delzenne N.M., Schrenzel J., François P, & Cani P.D. (2014). Microbiome of prebiotic-treated mice reveals novel targets involved in host response during obesity. The ISME Journal, 8(10), 2116-2130.

+ Open protocol

+ Expand

Quantifying Gut Microbiome Composition

Check if the same lab product or an alternative is used in the 5 most similar protocols

For microbial DNA, frozen faecal pellets, caecal content and whole ileum with content were resuspended in 1.4 ml ASL buffer (Qiagen) and homogenized with 2.8 mm ceramic beads followed by 0.5mm glass beads using an OMNI Bead Ruptor (OMNI International). DNA was extracted from the entire resulting suspension using QiaAmp mini stool kit (Qiagen) according to manufacturer's protocol. DNA was quantified using Qubit broad range DNA assay (Life Technologies). A total of 10 ng of DNA was used for quantitative PCR (qPCR) reactions for A. muciniphila (AM1: 5′CAGCACGTGAAGGTGGGGAC′, AM2: 5′CCTTGCGGTTGGCTTCAGAT)52 (link) and total bacteria (UniF340: 5′ACTCCTACGGGAGGCAGCAGT, UniR514: 5′ATTACCGCGGCTGCTGGC)53 (link). qPCR was performed using Fast SYBR master mix (Applied Biosystems) and StepOne Plus Real Time PCR system and software (Applied Biosystems).

Greer R.L., Dong X., Moraes A.C., Zielke R.A., Fernandes G.R., Peremyslova E., Vasquez-Perez S., Schoenborn A.A., Gomes E.P., Pereira A.C., Ferreira S.R., Yao M., Fuss I.J., Strober W., Sikora A.E., Taylor G.A., Gulati A.S., Morgun A, & Shulzhenko N. (2016). Akkermansia muciniphila mediates negative effects of IFNγ on glucose metabolism. Nature Communications, 7, 13329.

+ Open protocol

+ Expand

Real-time PCR for Mouse Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR was performed with the StepOnePlus real-time PCR
system and software (Applied Biosystems, Den Ijssel, the Netherlands) using
GoTaq qPCR mix (Promega, USA) for detection, according to the manufacturer’s
instructions. Primer sequences for the mouse genes are shown in ESM Table
1.

Moens de Hase E., Neyrinck A.M., Rodriguez J., Cnop M., Paquot N., Thissen J.P., Xu Y., Beloqui A., Bindels L.B., Delzenne N.M., Van Hul M, & Cani P.D. (2023). Impact of metformin and Dysosmobacter welbionis on diet-induced obesity and diabetes: from clinical observation to preclinical intervention. Diabetologia, 67(2), 333-345.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analysing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega). Real-time PCR was performed with the StepOnePlus real-time PCR system and software (Applied Biosystems) using Mesa Fast qPCR (Eurogentec) for detection according to the manufacturer’s instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2^−ΔΔCT method. The identity and purity of the amplified product were assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table 4.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche Diagnostics, Mannheim, Germany). Quantification and integrity analysis of total RNA were performed by analysing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit; Agilent, Waghaeusel-Wiesental, Belgium). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega, Leiden, The Netherlands). Real-time PCR was performed with the StepOnePlus real-time PCR system and software (Applied Biosystems, Den Ijssel, The Netherlands) using Mesa Fast qPCR (Eurogentec, Seraing, Belgium) for detection according to the manufacturer's instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2^−ΔCT method. The identity and purity of the amplified product was assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table S4.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!