Platinum taq polymerase enzyme

The lentiviral vectors (System Biosciences) encoding miR-16 and other miRNAs were packaged and used to infect cell lines KP1-KP3, as described previously (Sachdeva et al., 2012 (link)). Briefly, pre-miR-16, pre-miR-146, pre-miR-223 and pre-miR-342 sequences were first PCR amplified using mouse genomic DNA as a template and Platinum Taq polymerase enzyme (Invitrogen) with corresponding specific primers. Primer sequences are shown in supplementary material Table S2. The amplified fragment was then cloned into a lentiviral vector (pCDH-CMV-MCS-EF1-copGFP from System Biosciences, Mountain View, CA) at EcoRI and NotI sites using the Choo-Choo cloning kit per the manufacturer's protocol (MCLAB, San Francisco, CA). The lentiviral vector was packaged using the pPACKH1 Lentivector Packaging Kit (Systems Biosciences, Mountain View, CA).

Amplification of the MG599854 gene was performed by RT-PCR with Platinum Taq Polymerase enzyme (Invitrogen, Thermo Fisher, US). For primer design, we used the Primer3 V.0.4.0 [48] and M.Arenaria_Scaff164g004450 transcript sequence as a template (Bioproject ID: PRJEB8714, sample: ERS1696677 [49]). SignalP was used to avoid the generation of primers on a signal peptide region. The primer-obtained sequences were the following: 5ʹ GAGTCTATACCTAACTACTACG 3ʹ and 5ʹ TCAAATACCGAAATCTGT 3ʹ. Finally, nematode GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) (accession number U7257.1) was employed as an internal control to assess the quality of the synthesized cDNA. GAPDH primers were also designed by Primer3 V.0.4.0 and their sequences were the following: 5ʹ GGTTACAGTTCCCGTGTGATTG 3ʹ and 5ʹ AGACCACTCCAGGCCCACAAAA 3ʹ. Furthermore, cleavage sites of the restriction enzymes NotI (5ʹ … … 3ʹGCGGCCGC) and ClaI (ATCGAT 5ʹ … … 3 ‘) were added to the 5ʹ end of the forward and reverse primers of each gene, which are necessary for subsequent cloning assays.
Before obtaining the sequences of the amplified products, they were purified by the QIAquick PCR purification kit (Qiagen Corporation, US). The sequences were sequenced and analyzed.

The fungi that developed were quantified and grouped into morphotypes and identified using conventional taxonomic keys [18 , 19 ]. The morphological identification was associated with DNA sequencing analysis. Identification by DNA sequencing initiated with culture DNA was extracted with the kit QIAamp Tissue and Blood (Qiagen, Hilden, Germany) according to manufacturer. The PCR was performed in accordance with [20 ] from the amplification of the regions ITS (ITS1-5′ TCC GTA GGT GAA CCT GCGG 3′ and ITS4-5′ TCC TCC GCT TAT TGA TAT GC 3′). The following were used: 40 ng of DNA in a final volume of 30 µL, with 1X reaction buffer (200 mM TrisHCl (pH 8.4), 500 mM KCl); 0.2 mM of each nucleotide; 2 mM of magnesium chloride (MgCl₂); 50 ng of each primer; and 2.5U of Platinum® Taq polymerase enzyme (Invitrogen, Brazil). The amplicons were sequenced according to the instructions from the manufacturer of the kit “BigDye®Terminator v3.1 Cycle Sequencing Kit” (Applied Biosystems) and capillary electrophoresis was performed in an ABI 3130 Genetic Analyzer sequencer. The sequences were analyzed in the Sequencher 5.4.6 program and then compared with existing sequences in the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and the Wester Dijk Fungal Biodiversity Institute (https://wi.knaw.nl/page/Pairwisealignment).