Samples were tested for HPV DNA using the highly sensitive SPF10-PCR DEIA/LiPA25 system (version 1). If tested positive for HPV types 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 and/or 59, we determined the HPV VL by using a previously described quantitative type-specific (q)PCR targeting the L1 region, optimized to approach SPF10-LiPA25 sensitivity levels [16 (link),17 ]. HPV VLs were corrected for the number of human cells in each sample and expressed as genomes per human cell [16 (link)]. qPCRs were performed in 20 μl final volume using LightCycler TaqMan Master on the Roche LightCycler 480 platform (Roche Diagnostics, Almere, the Netherlands). The lower limit of detection varied for each HPV type, ranging from 200 to 920 copies/ml [16 (link),17 ]. HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 and 59 were defined as high-risk HPV (hrHPV) and types 6, 11, 34, 40, 42, 43, 44, 53, 54, 66, 68/73, 70 and 74 as low-risk HPV (lrHPV). HPV VL was categorized in three groups: (1) hrHPV and HPV 6/11 negative, (2) hrHPV and/or HPV 6/11 positive with an undetectable VL, and (3) hrHPV and/or HPV 6/11 positive with a detectable VL. This classification was made to distinguish between possible HPV deposition (group 2) and actual HPV infection (group 3).
Lightcycler taqman master
Manufactured by Roche
Sourced in Germany, United States, Switzerland
The LightCycler TaqMan Master is a reagent kit that enables real-time PCR amplification and detection of target DNA sequences. The kit includes essential components required for performing quantitative PCR analysis, such as a DNA polymerase enzyme, buffer solution, and fluorescent probes. It is designed for use with the LightCycler real-time PCR instrument.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 2, by Roche (6 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
High pure rna isolation kit, by Roche (3 mentions)
Lightcycler software version 3, by Roche (3 mentions)
Realtime ready assay, by Roche (2 mentions)
Oligo dt15 primers, by Roche (2 mentions)
Omniscript reverse transcription kit, by Qiagen (2 mentions)
Lightcycler 2.0 2, by Roche (2 mentions)
Lightcycler faststart dna master sybr green 1, by Roche (2 mentions)
Rneasy midi column, by Qiagen (2 mentions)
Lightcycler 1.5 instrument, by Roche (2 mentions)
High pure rna isolation kit, by Qiagen (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Universal probe library system, by Roche (2 mentions)
Maxwell 16 ffpe plus lev dna purification kit, by Promega (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480, by Roche (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
41 protocols using lightcycler taqman master
1
Quantitative HPV Typing and Viral Load
2
Quantifying p21 Expression in SCCHN Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As read-out for p53 transcriptional activity in SCCHN cell lines, basal and irradiation-induced p21 expression levels were determined by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Total cellular RNA extraction was performed using the High-Pure RNA Isolation kit (Roche Diagnostics, Mannheim, Germany). Synthesis of cDNA was done with the ‘Omniscript Reverse Transcription kit’ (QIAGEN, Hilden, Germany) according to the supplied protocol using random hexamers and oligo dT15 primers (Roche, Basel, Switzerland) and 2 µg of total RNA.
The quality of RNA was checked by GAPDH PCR and only samples positive for GAPDH transcripts were used for analysis. Realtime PCR was performed in a reaction volume of 20 µl containing 2 µl cDNA, Light Cycler TaqMan Master (Roche), primers and probes for p21 and the housekeeping gene porphobilinogen deaminase (PBGD) in concentrations recommended by the manufacturer (Real Time Ready Assays, Roche). PCR cycling was performed using the Light Cycler 480 II (Roche). Relative quantification of p21 expression was done by normalization to the expression levels of PBGD using the ΔCt-method.
The quality of RNA was checked by GAPDH PCR and only samples positive for GAPDH transcripts were used for analysis. Realtime PCR was performed in a reaction volume of 20 µl containing 2 µl cDNA, Light Cycler TaqMan Master (Roche), primers and probes for p21 and the housekeeping gene porphobilinogen deaminase (PBGD) in concentrations recommended by the manufacturer (Real Time Ready Assays, Roche). PCR cycling was performed using the Light Cycler 480 II (Roche). Relative quantification of p21 expression was done by normalization to the expression levels of PBGD using the ΔCt-method.
3
RT-PCR Analysis of SLC34B4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was performed using 5X RT-PCR Master Mix (LightCycler Taqman Master, Roche, Basel, Switzerland) in a CFX96 system (Bio-Rad). The reaction was performed as follows: pre-cycle of 50 °C for 2 min then 95 °C for 10 min followed by 50 cycles each consisting of an initial 95 °C step for 10 s, then 57 °C for 45 s and finally 72 °C for 5 s. Gene expression levels were calculated relative to the G6PD control using the 2−ΔΔCt calculation. Primer sequence for SLC34B4 gAACTgCATggTCATAAATATCAgAAgCC: FL and LC640-AgAAgACgAAACCCggAAgTggA: PH.
4
Quantifying Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was collected from cultured cells using TRIzol Reagent (Thermo Fisher Scientific), and complementary DNA was synthesized from 1.0 μg total RNA using oligo dT primer and a Reverse Transcription System (Promega) according to the manufacturer's instructions. Quantitative real‐time PCR (q‐PCR) was carried out using LightCycler FastStart DNA Master SYBR Green I (Roche) or LightCycler TaqMan Master (Roche) on a LightCycler 2.0 II (Roche).
Expression of the target gene was normalized relative to β2M mRNA expression using the 2−ΔΔCt method. Primers are shown in TableS2 .
Expression of the target gene was normalized relative to β2M mRNA expression using the 2−ΔΔCt method. Primers are shown in Table
5
Quantitative Expression Profiling of Ion Channels and Circadian Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR was performed in a final volume of 10 μL containing 4.1 μL of PCR grade water, 1 μL of Universal Probe Library probe (Roche, Tokyo, Japan), 0.2 μL each of forward and reverse primers (10 μM each), 2 μL of Light Cycler TaqMan Master (Roche, Tokyo, Japan), and 2.5 μL of complementary DNA (cDNA). The mRNA levels of TRPV1 (GenBank, NM_031982.1), TRPV4 (GenBank, XM_006249466.2), VNUT (GenBank, NM_001108613.1), Piezo1 (GenBank, NM_001077200.2), Rev-erbα (GenBank, NM_001113422.1), Per2 (GenBank, NM_031678.1), Bmal1 (GenBank, NM_024362.2), Cry2 (GenBank, NM_133405.2), and Clock (GenBank, NM_001289832.1) were assessed using a Light Cycler Fast Start DNA Master SYBR Green 1 RT-PCR assay (Roche, Tokyo, Japan) with ß-actin (GenBank, NM_031144.3) as the housekeeping gene (Table 1 ). Thermal cycle conditions were held at 95°C for 10 min followed by 45 cycles of 95°C for 30 s and 60°C for 1 min.
6
BoNT-Producing Clostridia Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Analyses were performed using methods enabling ntnh and bont/A-F gene detection. The DNA extracted from liquid cultures and suspected isolates previously characterized by the culture method (showing lipolytic properties and the subterminal location of spores) and 16S rDNA analysis was examined.
The ntnh gene is common in all BoNT-producing Clostridia toxin types and was detected using a set of seven primers and the TaqMan probe described by Raphael and Anreadis in 2007 [45] (link) and with the reagent concentrations, as previously described [34] .
After obtaining positive results, the DNA was subjected to determination of the bont/A-F genes with primers, probes, and a temperature profile described by Kirhner et al., 2010 [46] (link).
The reactions were conducted using a version of singleplex real-time PCR and prepared with the subsequent reagents: 5 µL of DNA, 4 µL of LightCycler TaqMan Master (Roche, Basel, Switzerland), 0.7 µM of each primer, and 0.24 µM of TaqMan probe. The realtime PCR was performed using a LightCycler 2.0 thermocycler (Roche, Basel, Switzerland) on the following thermal cycling profile: activation of the Taq DNA polymerase at 95 • C for 15 min, followed by 45 cycles of 95 • C for 15 s and 60 • C for 40 s.
All reactions were conducted on a LightCycler 2.0 instrument (Roche, Basel, Switzerland).
The ntnh gene is common in all BoNT-producing Clostridia toxin types and was detected using a set of seven primers and the TaqMan probe described by Raphael and Anreadis in 2007 [45] (link) and with the reagent concentrations, as previously described [34] .
After obtaining positive results, the DNA was subjected to determination of the bont/A-F genes with primers, probes, and a temperature profile described by Kirhner et al., 2010 [46] (link).
The reactions were conducted using a version of singleplex real-time PCR and prepared with the subsequent reagents: 5 µL of DNA, 4 µL of LightCycler TaqMan Master (Roche, Basel, Switzerland), 0.7 µM of each primer, and 0.24 µM of TaqMan probe. The realtime PCR was performed using a LightCycler 2.0 thermocycler (Roche, Basel, Switzerland) on the following thermal cycling profile: activation of the Taq DNA polymerase at 95 • C for 15 min, followed by 45 cycles of 95 • C for 15 s and 60 • C for 40 s.
All reactions were conducted on a LightCycler 2.0 instrument (Roche, Basel, Switzerland).
7
Quantitative RT-PCR Analysis of Bacterial Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from early-exponential-phase grown bacteria cells by use of the RNeasy midi-column (QIAGEN) according to the manufacturer's instructions. RNA was DNase-treated with RNase-free DNase I (MoBioPlus) to eliminate DNA contamination. RNA of 100-ng was reverse-transcribed with the Transcriptor First Strand cDNA Synthesis Kit (Roche) using random primers. qRT-PCR was performed in a Roche LightCycler 1.5 Instrument using LightCycler TaqMan Master (Roche). Primers and probes were designed for selected target sequences using Universal ProbeLibrary Assay Design Center (Roche-applied science) and listed in Table 3 . Data were analyzed using the real time PCR software of Roche LightCycler 1.5 Instrument. Relative gene expressions were quantified using the comparative threshold cycle 2−ΔΔCT method with 23S rRNA as the endogenous reference.
8
RT-qPCR Assay for Cytokine Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RealTime‐PCR was performed using LightCycler® TaqMan® Master (Roche) according to the manufacturer's instructions. Primers were designed using the Roche UniversalProbeLibrary Assay Design Centre (http://www.universalprobelibrary.com/ ): glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) (forward primer: 5′‐agccacatcgctcagacac‐3′, reverse primer: 5′‐gcccaatacgaccaaatcc‐3′, UPL probe #60; Amplicon Size [bp] 66) – IL‐33 (forward primer: 5′‐agcaaagtggaagaacacagc‐3′, reverse primer: 5′‐cttctttggccttctgttgg‐3′, UPL probe #33, Amplicon Size [bp] 74) – sST2 (forward primer: 5′‐gggagagatatgctacctggag‐3′, reverse primer: 5′‐ cgcctgctctttcgtatgtt‐3′, UPL probe #86, Amplicon Size [bp] 68) – ST2L (forward primer: 5′‐ gaaatacctgagactgggtgatttat 3′, reverse primer: 5′‐gaagtgcctgcctttgctt‐3′, UPL probe #29, Amplicon Size [bp] 149). The amplification conditions consisted of an initial incubation at 95°C for 10 minutes, followed by 45 cycles of 95°C for 10 seconds, 63°C for 20 seconds and 72°C for 6 seconds and a final cooling to 4°C. Data were analyzed using LightCycler Software Version 3.5 (Roche).
9
Detection of Clostridium botulinum ntnh Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The set of 7 primers and TaqMan probe were used for detection of the ntnh gene according to Raphael and Andreadis 2007 [34 (link)]. The reaction was conducted with subsequent concentrations of reagents: 5 μL of DNA, 4 μL of LightCycler TaqMan Master (Roche, Basel, Switzerland), 0.7 μM of each primer and 0.24 μM of NTNH410 TaqMan probe. The real-time PCR was performed using a LightCycler 2.0 thermocycler (Roche, Basel, Switzerland) on the following thermal cycling profile: 10 min at 95 °C as initial denaturation and 40 cycles of denaturation at 95 °C for 15 s, annealing at 42 °C for 15 s, and elongation at 55 °C for 1 min. Validation results of this method for food samples are described in a previous publication [33 ].
10
Transcriptional Response to Vacuolating Cytotoxin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sub-vacuolating concentration of VCC was added to 1 × 106 THP-differentiated cells, followed by incubation for 10, 15, 30 and 60 min, respectively. The positive control was 1 mg of LPS, and the negative control was the cells without treatment. Total RNA was extracted using Roche’s High Pure RNA Tissue kit, and then the cDNA from each treatment was synthesized from approximately 500 ng of RNA using Roche’s First Strand cDNA Synthesis Transcription Kit. The generated cDNA was used to perform duplicates of qRT-PCR assays using Roche’s Light Cycler TaqMan Master. The following primers were used: p50_Fwd:5′-caccgaagcaattgaagtga-3′, p50_Rev: 5′-ggcctgagaggtggtcttc-3′, jun_Fwd: 5′-ccaaaggatagtgcgatgttt-3′, jun_Rev: 5′-ctgtccctctccactgcaac-3′, fos_Fwd: 5′-ctaccactcacccgcagact-3′, fos_Rev: 5′-aggtccgtgcagaagtcct-3′, gapdh_Fwd: 5′-agccacatcgctcagacac-3′ and gapdh_Rev: 5′-gcccaatacgaccaaatcc-3′. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping control gene. All reactions were performed in the LightCycler 2.0 (Roche, Basel, Switzerland) real-time equipment, and the relative transcription results were normalized against GAPDH using the ΔΔCt method [33 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!