Dzup genomic dna isolation reagent

After being treated with different formulations, the genomic DNA of A549 cells was harvested on day 3 using Dzup Genomic DNA Isolation Reagent (Sangon Biotech Co. Ltd., Shanghai, China) according to the manufacturer’s instructions. The sgRNA-targeted genomic locus was amplified with the High Fidelity PCR Master Mix (Sangon Biotech Co. Ltd., Shanghai, China) using the following primers: GGTGCTGCGAATGGTTGTGG and CAGCCTCCTCCAAATTCCAGC. To reduce nonspecific amplifications, the touchdown polymerase chain reaction (PCR) program [(92°C for 15 s and 74°C for 60 s) for 5 cycles, (95°C for 15 s and 72°C for 60 s) for 5 cycles, (95°C for 15 s and 70°C for 60 s) for 5 cycles, (95°C for 15 s and 68°C for 60 s) for 25 cycles, and 68°C for 5 min] was used. After purifying by gel extraction, indel formation efficiencies were detected according to the T7 Endonuclease I Kit (Viewsolid Biotech, Beijing, China). The digested DNA was analyzed using 2% agarose gel electrophoresis. Indel formation efficiencies were calculated by Image J.

All of the oligonucleotide sequences are shown in Supplementary Table S1. DNA sequences were obtained from Sangon Biotech (Shanghai, China). RNA oligonucleotides were synthesized by Generay Biotech (Shanghai, China). An sgRNA in vitro transcription kit and SpCas9 and dCas9 proteins were obtained from Inovogen Tech. Co. Ltd (Beijing, China). RNase inhibitor, Dzup genomic DNA isolation reagent, High-Fidelity PCR Master Mix and a SanPrep column polymerase chain reaction (PCR) product purification kit were purchased from Sangon Biotech (Shanghai, China). 4,4′-Dihydroxyazobenzene and 1-(2-chloroethyl) piperidine hydrochloride were obtained from Aladdin Biochemical Tech Co., Ltd (Shanghai, China). Lipofectamine 3000 transfection agent and E-Gel EX agarose gels were purchased from Thermo Fisher Scientific Inc. (MA, USA). The pSLQ1658-dCas9-EGFP plasmid was obtained from Addgene. A T7 endonuclease I kit was purchased from Vazyme (Nanjing, China). The concentration of nucleic acids was quantified using a NanoDrop 2000c (Thermo Scientific, MA, USA).