Lentiviral vector construction was performed as previously reported (15 (link)). Briefly, short hairpin RNA (shRNA) against the human TAF-Iβ gene [shRNA-knockdown (KD)] and scramble shRNA, which acts as a negative control (shRNA-NC), were constructed by Shanghai GeneChem Co., Ltd. (Shanghai, China). The leukemic cells were then transfected with the shRNA-KD or shRNA-NC vectors using Lipofectamine® 2000. The green fluorescent protein (GFP)-positive cells were counted under a fluorescence microscope. The RNA interference efficiency was evaluated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analyses.
Shrna nc
Manufactured by Genechem
Sourced in China
ShRNA-NC is a negative control small hairpin RNA (shRNA) product designed for use in gene knockdown studies. It does not target any known genes and serves as a control for off-target effects during shRNA-mediated gene silencing experiments.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (6 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (5 mentions)
Inhibitor nc, by Thermo Fisher Scientific (2 mentions)
Ov nc, by Genechem (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Pcdh cmv mcs ef1 copgfp, by System Biosciences (2 mentions)
Shrna nc, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions)
Oe nc, by Genechem (1 mentions)
Nc sirna, by RiboBio (1 mentions)
Lipo8000 transfection reagent, by Beyotime (1 mentions)
Lv shrna rac1, by Genechem (1 mentions)
Pc nc, by Genechem (1 mentions)
Pcdna nc, by Genechem (1 mentions)
Inhibitor nc, by Genechem (1 mentions)
Oe nc, by Thermo Fisher Scientific (1 mentions)
Nc mimic, by Thermo Fisher Scientific (1 mentions)
Mimic nc, by Genechem (1 mentions)
Oe nc, by GenePharma (1 mentions)
Ov hoxb2, by Genechem (1 mentions)
25 protocols using shrna nc
1
Lentiviral Knockdown of TAF-Iβ
2
Targeting SNHG12 and miR-4429 in RL95-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of short hairpin RNAs (shRNAs) targeting SNHG12 (shRNA-SNHG12-1 and shRNA-SNHG12-2) and their negative control (NC) sequence (shRNA-NC), were designed and synthesized by Shanghai GeneChem Co., Ltd, and cloned into the pSUPER-retro-puromycin plasmids (cat. no. VEC-pRT-0002; OligoEngine), according to the manufacturer's instructions. The SNHG12 overexpression plasmid (OV) was established by inserting the full-length human SNHG12 cDNA (Aksomics Inc.) into the pcDNA3.1 vector (Invitrogen; Thermo Fisher Scientific, Inc.), whereas an empty vector served as the NC (OV-NC). miR-4429 mimics (cat. no. miR10018944-1-5) and corresponding NC mimics (mimic-NC; cat. no. miR1N0000002-1-5) were purchased from Guangzhou RiboBio Co., Ltd. After RL95-2 cells (1×106) were transfected with 50 nM plasmids, including shRNA-SNHG12-1, shRNA-SNHG12-2, shRNA-NC, OV-SNHG12, OV-NC, miR-4429 mimics and mimic-NC, using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C, the transfection efficiency was evaluated at 48 h after transfection using reverse transcription-quantitative PCR (RT-qPCR).
3
Modulating RP11-838N2.3 Expression for Cisplatin Sensitivity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The overexpression vector targeting RP11-838N2.3 (OE) as well as a negative control (OE-NC) (Genechem, Shanghai, China) transfected A549 cell. According to experimental requirements, these groups were divided into A549 OE-NC, A549 OE-NC+2 μg/ml cisplatin, A549 OE, and A549 OE+2 μg/ml cisplatin. A549/DDP cell was transfected shRNA vector targeting RP11-838N2.3 (shRNA) as well as a negative control (shRNA NC) (Genechem, Shanghai, China); shRNA included four sequences—shRNA-1: 5′-TTCCTTCAGCCTCCAGGAATA-3′, shRNA-2: 5′-CTCTTTAGGGAC AGAGAGGAA-3′, shRNA-3: 5′-ATGGCAGGAGCAAGTGGTTAT-3′, and shRNA-NC: 5′-TTCTCCGAACGTGTCACGT-3′. The optimal interfering sequence was screened by three shRNA sequence experiments as the subsequent experimental group. These groups were divided into A549/DDP shRNA-NC, A549/DDP shRNA-NC+2 μg/ml cisplatin, A549/DDP shRNA, and A549/DDP shRNA+2 μg/ml cisplatin. Transfection was performed with adding 2 × 105 cells into a six-well plate, and after 24 h, the medium was aspirated and incubated with transfection complex abiding by the manufacturer's protocol and MOI value (MOI = 5). These cells were infected by lentivirus for 72 h and treated with 2 μg/ml puromycin; further, qPCR detected the overexpression or shRNA efficiency.
4
Targeting circWDR62 with siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A small interfering RNA (siRNA) targeting circWDR62 (siRNA-circWDR62) and a matched negative control siRNA (siRNA-NC) were synthesized by RiboBio (Guangzhou, China). An miR-370-3p inhibitor and matched negative control (inhibitor-NC) were synthesized by Thermo Fisher Scientific. Lentivirus-packaged shRNA-circWDR62 and its negative control (shRNA-NC) were provided by GeneChem Company (Shanghai, China). MGMT overexpression vectors and an empty vector were synthesized by Addgene (Cambridge, USA). Cells were transfected by using Lipofectamine 3000 (Thermo Fisher Scientific, USA). The oligo sequences used for transfection in this research are listed in Supplementary Table S2 .
5
Lentiviral Knockdown of MFG-E8 in Primary Schwann Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LV-MFGE8-EGFP inhibitor vector was constructed from the lentiviral vector (GeneChem, shanghai, China). Negative control was constructed by LV empty lentivirus (LV-NC-EGFP). The short hairpin RNA (shRNA) sequences of MFG-E8 protein (shRNA-MFG-E8) and negative control (shRNA-NC) were designed and synthesized by GeneChem (Shanghai, China). HitransG P Infection Enhancement Reagent (25×) was used to transfect cells at the multiplicity of infection (MOI) value of 50. After the cultured primary SCs were infected with these lentiviruses, the SCs cell growth medium was replaced. The culture was continued for 72 h to observe the transfection efficiency. Brightfield and fluorescence images were taken with a fluorescence microscope. The knockout efficiency of the target protein was evaluated via western blot.
6
Overexpression and Knockdown of c-Myc and FUBP1 in HCT116 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The overexpression of c-Myc (Ov-c-Myc) and the overexpression-negative control (Ov-NC), short hairpin RNA carrying FUBP1 (shRNA-FUBP1, 5’-GCTGCTTATTACGCTCACTAT-3’) and shRNA-Negative Control (shRNA-NC, 5’-TTCTCCGAACGTGTCACGT-3’) were synthesized by Shanghai GeneChem Co., Ltd. HCT116 cells were kept in culture on 12-well plates (3x105 cells/well) in a 5% CO2 incubator at 37°C for 24 h. Following incubation, cell transfection was immediately carried out with the aforementioned vectors applying Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific) as per the operating procedures of the reagent. The transfection efficiency of genes was evaluated by reverse transcription-quantitative PCR (RT-qPCR) post 48 h [23 (link)].
7
Targeted Regulation of DEC1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviruses containing short hairpin RNAs specially targeting DEC1 (shRNA-DEC1) or the scramble control short hairpin RNA (shRNA-NC) were purchased from GeneChem (Shanghai, China). Cells were cultured for 24 h in a 6-well plate (8 × 104 cells/well), and then transfected with scrambled shRNA or DEC1 shRNA at a MOI of 40. After 8 h, the medium was replaced with 10% RPMI-1640 medium for 72 h when the cells reached 70–80% confluence. Then the cells were incubated with 3 μg/ml puromycin to select stable cell line. Knockdown efficiency was verified by western blotting. For DEC1 overexpression plasmids construction and transfection, human DEC1 cDNA was purchased from GeneChem (Shanghai, China). Transfection was carried out using the Lipo8000™ Transfection Reagent (Beyotime, Shanghai, China) according to the manufacturer’s instructions. Overexpression efficiency was verified by western blotting.
8
Lentiviral Knockdown of NAP1L1 in Colon Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral particles carrying shRNA-NAP1L1 or shRNA-NC were designed and constructed by GeneChem (Shanghai, China). The colon cancer cells were then transfected with shRNA-NAP1L1 or shRNA-NC, and the transfection efficiencies were evaluated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis to evaluate the NAP1L1 expression. Plasmids were purchased from Vigene Biosciences (Jinan, China), and siRNAs were designed and synthesized by Guangzhou RiboBio (Guangzhou, China). Before transfection, exponentially growing cells were seeded in a cell culture plate or dish (Wuxi NEST Biotechnology, Wuxi, China). Plasmids and siRNAs were then transfected into the cells using Lipofectamine TM 2000 (Invitrogen, Carlsbad, USA) according to the manufacturer’s protocol. Cells were collected 48–72 h after transfection for further experimentation. The sequence information of shRNAs are shown in
Supplementary Table S1 .
9
Generating Lentiviral Vectors for RAC1 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three pairs of shRNA sequences targeting the human RAC1 gene were designed using the latest version of the online RNAi design web tool (http://jura.wi.mit.edu/bioc/siRNA ), as listed in Table I . The negative control duplexes of shRNA (shRNA-NC) were random sequences (TTCTCCGAACGTGTCACGT), which did not target any known mammalian gene, using the Blast website (https://blast.ncbi.nlm.nih.gov/Blast.cgi ). The shRNA sequences were then cloned into the lentiviral vector GV248 (hU6-MCS-Ubi-EGFP-IRES-Puro; Shanghai GeneChem Co., Ltd., Shanghai, China). Lentivirus (LV) (LV-shRNA-RAC1 and LV-shRNA-NC) amplification and packaging was conducted according to the lentiviral packaging protocol (Shanghai GeneChem Co., Ltd.). Briefly, the 293T packaging cell line was cotransfected with GV248 carrying shRNA (LV-shRNA-RAC1 and LV-shRNA-NC) and pHelper plasmids. The next day, medium was replaced with fresh DMEM and culture was continued for 24 h at 37°C. The viral supernatant was then collected, filtered, concentrated and stored in small aliquots at −80°C for titration and cell infection.
10
Lentiviral Knockdown of MMP7 in Tongue Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral vector constructs of MMP7 (shRNA-208, shRNA-720) corresponding to the negative control (shRNA-NC) were purchased from Shanghai Genechem Co. Ltd., China. Our research group previously isolated a high-metastasis tongue cancer cell line from CAL27 named LN4. LN4 cells were infected by these lentiviral vectors follow the manufacturer’s instructions to establishing the stabilized cell lines, which knocked down MMP7. The effect of knocking down was confirmed by quantitative real-time PCR and Western blotting analysis. The designed and chemically synthesized shRNA sequences were as follows: shRNA-208: Sense 5′-CCGGCCAACAGTTTAGAAGCCAACTCGAGTTGGCTTCT AAACTGTTGGTTTTTG-3′/Antisense 5’AATTCAAAAACCAACAGTTTAGAAGCC AACTCGAGTTGGCTTCTAAACTGTTGG-3′; shRNA-720: Sense 5′-CCGGGGAC ATTCCTCTGATCCTACTCGAGTAGGATCAGAGGAATGTCCTTTTTG-3′/ Antisense5’-AATTCAAAAAGGACATTCCTCTGATCCTACTCGAGTAGGATCAGAG GAATGTCC − 3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!