Tpcn1 forward primer 5′CTGTCCTCTGGATGGAACCT3′;
Tpcn1 forward primer 5′CTGTCCTCTGGATGGAACCT3′;
Tpcn2 forward primer 5′CCCTGGCTGTATACCGATTG3′;
Tpcn2 reversed primer 5′GTCCCAGAGCGACAGTGG3′;
GAPDH forward primer 5′TGACGTGCCGCCTGGAGAAA3′;
The NanoPhotometer® N120 is a compact and portable UV/Vis spectrophotometer designed for accurate and precise nucleic acid and protein concentration measurements. It features a wavelength range of 200-840 nm and a sample volume as low as 0.5 μL.
Tpcn1 forward primer 5′CTGTCCTCTGGATGGAACCT3′;
Tpcn1 forward primer 5′CTGTCCTCTGGATGGAACCT3′;
Tpcn2 forward primer 5′CCCTGGCTGTATACCGATTG3′;
Tpcn2 reversed primer 5′GTCCCAGAGCGACAGTGG3′;
GAPDH forward primer 5′TGACGTGCCGCCTGGAGAAA3′;
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!