2 μg (cell lines) or 200 ng (primary tumors) of RNA were used in cDNA synthesis by Superscript VILO (LifeTechnologies), per manufacturer protocol. Yields were diluted per protocol and 2 μL of resulting product used in qPCR, using the Eppendorf RealPlex Mastercycler and KiCqStart Mastermix (Sigma Aldrich), per manufacturer protocols. qPCR was performed for 40 cycles, and Tm analysis used to confirm purity of PCR amplification. Primers are listed in Supplementary Methods . Relative gene expression was calculated using the ΔΔCt method, using 18SRNA as reference, and samples compared to SHSY5Y cells grown in complete media for normalization. Samples were tested in triplicate on three separate experiments.
Kicqstart mastermix
Manufactured by Merck Group
KiCqStart Mastermix is a ready-to-use solution for real-time PCR and quantitative PCR (qPCR) applications. It contains all the necessary components, including a hot-start DNA polymerase, dNTPs, and buffer, to perform efficient and sensitive DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Superscript vilo, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
7500 real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Aurum kit, by Bio-Rad (1 mentions)
Cfx96 real time pcr machine, by Bio-Rad (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy plus kit, by Qiagen (1 mentions)
2 protocols using kicqstart mastermix
1
Quantitative PCR of Cell Lines
2
Mitochondrial Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from infected OCI-AML2 cells using the RNEasy plus kit (Qiagen) or an Aurum kit (Bio-Rad Laboratories, Inc.) Cells were assessed at 4 or 6 days post-infection for the shRNA studies, or at 24 hours after 2-CM. cDNA was synthesized using random priming and Superscript III (Life Technologies.) TaqMan analysis of genes ND3, ND6, CO2, ATP8 and 18S was performed using primers and probes (Applied Biosystems, Inc.) and Taqman Gene expression master Mix (Applied Biosystems) and an Applied Biosystems 7500 Real Time PCR instrument. Standard curves with variable amounts of cDNA input were conducted to confirm linearity of response. Experiments were performed in triplicate and relative expression was determined using the delta delta Ct method. Mitochondrial gene expression was normalized to 18S expression, and data were expressed relative to shGFP controls. RNA content was determined using A260/280 on a Nanodrop spectrophotometer (Thermo Scientific).
For spRNAP-IV expression, primers p2 (Intron 1 forward) GTGGTTTCTTATGCAGCCTC gtggtttcttatgcagcctc and p3 (exon 3 reverse) ATCCTTCTCCAGTATCTTTGC were employed. KiCqStart Master Mix (Sigma) was utilized, with amplification in a BioRad CFX96 Real-time PCR machine, and expression was normalized to 18S.
For spRNAP-IV expression, primers p2 (Intron 1 forward) GTGGTTTCTTATGCAGCCTC gtggtttcttatgcagcctc and p3 (exon 3 reverse) ATCCTTCTCCAGTATCTTTGC were employed. KiCqStart Master Mix (Sigma) was utilized, with amplification in a BioRad CFX96 Real-time PCR machine, and expression was normalized to 18S.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!