Kicqstart mastermix
KiCqStart Mastermix is a ready-to-use solution for real-time PCR and quantitative PCR (qPCR) applications. It contains all the necessary components, including a hot-start DNA polymerase, dNTPs, and buffer, to perform efficient and sensitive DNA amplification.
Lab products found in correlation
2 protocols using kicqstart mastermix
Quantitative PCR of Cell Lines
Mitochondrial Gene Expression Analysis
For spRNAP-IV expression, primers p2 (Intron 1 forward) GTGGTTTCTTATGCAGCCTC gtggtttcttatgcagcctc and p3 (exon 3 reverse) ATCCTTCTCCAGTATCTTTGC were employed. KiCqStart Master Mix (Sigma) was utilized, with amplification in a BioRad CFX96 Real-time PCR machine, and expression was normalized to 18S.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!