Anti bax

Hesperetin (B20184-20 mg,  >  = 98%) was purchased from Yuanye, Shanghai. The concentration of HE was 600 mmol/L in dimethyl sulfoxide (DMSO, Beyotime, Shanghai) solution. After further HE dilution, the concentration of DMSO was ensured not to exceed 0.1%. The western blotting assay was performed with the following antibodies: anti-ACTIN (23660-1-AP, Proteintech, 1: 10,000), anti-BCL-2 (12789-1-AP, Proteintech, 1:1000), anti-BAX (505,992–2-lg, Proteintech, 1:1000), anti-Caspase-3/Cleaved-caspase-3 (196,771–1-AP, Proteintech, 1:1000), anti-MMP9 (10,375–2-AP, Proteintech, 1:1000), anti-GPX4 (67,763–1-lg, Proteintech, 1: 1000), anti-AKT (60203-2-lg, Proteintech, 1:1000), anti-P-AKT (66,444–1-lg, Proteintech, 1:1000), anti-PI3K(P110) (20584-1-AP, Proteintech, 1:1000), anti-SRC (11097-1-AP, Proteintech, 1: 1000), anti-PIK3R1(P85) (60,225–1-lg, Proteintech, 1:1000), anti-MMP2 (A19080, ABclonal, 1:1000), anti-MAPK1 (A19630, ABclonal, 1:1000).

pCMV-myc3-HDM2 (Addgene Plasmid #20935) was a gift from Yue Xiong, pcDNA3 flag p53 (Addgene plasmid # 10838) was a gift from Thomas Roberts, HA-tagged ubiquitin plasmids (WT, K48, and K63) were gift from Ted Dawson [16 (link)]. LentiCRISPRv2 was a gift from Feng Zhang (Addgene plasmid # 52961), and sgRNA specificly targeting human MYL6B (6Bsg1: ACTTTGGAGAGATCGACTGG; 6Bsg2: TTATACTTTAGAGTTCAAGG and 6Bsg3: TTCCCGTGAAGAAACCAGCA) were cloned into LentiCRISPRv2 following provider’s guide. Myc-DDK-tagged Human MYL6B ORF sequence was cloned into pCMV6 (OriGene). 3FLAG-tagged MYL6B ORF sequence was cloned into pcDNA3. Rabbit polyclone antibodies anti-p53, anti-Bax, anti-MYL6B, anti-MDM2 and mouse monoclone antibody anti-GAPDH were from Proteintech Inc. Rabbit polyclone antibody anti-ubiquitin were from Dako. Mouse monoclone anti-FLAG M2, anti-FLAG M2 Affinity Agarose Gel, and anti-c-Myc Affinity Agarose Gel was from Sigma-Aldrich.

Total protein from AGS and HGC27 cells was extracted using commercial kit, and the protein concentration was determined with BCA method. The samples were subjected to SDS–PAGE, and were transferred to the PDVF membrane that were placed in 5% BSA solution (ThermoFisher Scientific, MA, USA). The primary antibodies were incubated at four degrees overnight. The primary antibodies utilized in the experiments included anti-BAX (Proteintech, 50599-2-Ig, 1:1000), anti-β-action (Proteintech, 66009-1-Ig, 1:5000), anti-Bcl-2 (Proteintech, 68103-1-Ig, 1:1000), anti-PARP (Cell Signaling Technology, #9532, 1:1000), anti-Cleaved PARP (Cell Signaling Technology, #5625, 1:1000), anti-Caspase-3 (Cell Signaling Technology, #14220, 1:1000), anti-Cleaved Caspase-3 (Cell Signaling Technology, #9664, 1:1000), anti-PI3K (Affinity, AF6241, 1:1000), anti-p-PI3K (Affinity, AF3242, 1:1000), anti-AKT (Cell Signaling Technology, #4691, 1:1000), anti-p-AKT (Cell Signaling Technology, #4060, 1:1000), anti-EGFR (Proteintech, 66455-1-Ig, 1:1000), Anti-Cyt C (Proteintech, 10993-1-AP, 1:1000). The secondary antibodies were added and incubated at room temperature for 1 h. Finally, the bands were visualized using the IMAGE J software, with β-action serving as the internal standard.

Standard liquiritigenin of purity >98% was purchased from Aladdin Holdings Group Co., Ltd. (Shanghai, China). CP of over 98.5% purity (by HPLC) and the TUNEL kit were purchased from Beyotime Biotechnology (Shanghai, China). Annexin V-FITC/PI double staining apoptosis detection kit were obtained from BestBio (Shanghai, China). The antibodies used for Western blot analysis were as follows: anti-PGC-1α (Mouse, 1:1000, Catalog No.66369-1-Ig), anti-TFAM (Rabbit, 1:1000, Catalog No.22586-1-AP), anti-BCL-2 (Rabbit, 1:1000, Catalog No.26593-1-AP), anti-BAX (Mouse, 1:1000, Catalog No.60267-1-Ig), anti-β-actin (Mouse, 1:6000, Catalog No.66009-1-Ig), purchased from Protein Tech Group (Chicago, IL, USA), and anti-SIRT3 (Rabbit, 1:1000, Catalog No.ab189860), purchased from Abcam (Abcam, Cambridge, UK). Reagents related to cell culture such as culture medium, fetal bovine serum, and streptomycin and penicillin were purchased from Gibco (Shanghai, China).

Total protein was extracted from the cells using ice-cold RIPA lysis buffer and the protein concentration was measured using the BCA Protein Assay Kit. 30 µg total proteins were applied on 10% SDS-PAGE and transferred onto 0.45 mm PVDF membranes (Millipore, United States). The membranes were blocked with 5% non-fat milk for 2 h at room temperature, and then incubated with primary antibodies overnight at 4°C. After washing with TBST buffer three times, the membranes were incubated with secondary HRP-conjugated antibodies for 1 h at room temperature. Capture specific bands using the ECL detection system. The primary antibodies were anti-B4GALT1 (Abcam, ab121326, 1:1000), anti-Bcl-2(Proteintech, 12789-1-AP, 1:1000), anti-Bax (Proteintech, 50,599-2-lg, 1:1000), anti-C-caspase (Proteintech, 19677-1-AP, 1:1000) and anti-β-actin (Proteintech, 20536-1-AP, 1:1000).

Renal tissues were homogenized in RIPA lysis buffer (Sigma, St. Louis, MO, USA). Protein concentrations of the homogenates were measured by the BCA protein assay kit (Beyotime Institute of Biotechnology, Shanghai, China). The extracted proteins (50 μg) were separated on SDS-PAGE gel and transferred to a PVDF-nitrocellulose membrane. After blocking, the membranes were incubated with primary antibodies to detect the target proteins. Anti-extracellular signal-regulated protein kinase 1/2 (ERK1/2), anti-phospho (p)-ERK1/2 (Thr202/Tyr204), anti-c-Jun N-terminal kinase (JNK), anti-p-JNK (Thr183/Tyr185), anti-p38, anti-p-p38 (Thr180/Tyr182), anti-p50, anti-p65, and anti-p-p65 (Ser536) antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-Bax, anti-Bcl-2, anti-Caspase-3, anti-Cleaved Caspase-3, and anti-β-actin antibodies were purchased from ProteinTech (Chicago, IL, USA). The horseradish peroxidase-conjugated secondary antibody was purchased from Cell Signaling Technology. The reaction was visualized using an enhanced chemiluminescence system (Thermo Fisher Scientific, Rockford, IL, USA). The bands were quantified by densitometry using ImageJ software.

Proteins were subjected to SDS-PAGE on polyacrylamide gels (8–10%) and transferred onto a PVDF membrane. After blocking with 5% non-fat milk in TBS containing 0.1% Tween-20, the membrane was incubated at 4 °C overnight with one of the following primary antibodies: anti-p-NF-κB P65, anti-NF-κB P65, anti-p-mTOR, anti-p-ERK, anti-ERK, anti-PDCD4, anti-GNA12 (Affinity, USA); anti-mTOR, anti-GAPDH, anti-TSG101, anti-CD63, anti-CD81, anti-Bax (Proteintech, USA); anti-Bcl-2 (Abclonal, China). Subsequently, the peroxidase-conjugated AffiniPure goat anti-rabbit or mouse IgG (Proteintech, USA) was added. Bound antibody was visualized via ECL plus TM Western blotting system detection kit (Amersham, USA).