Abi sds software

Polymerase chain reaction for HCV was performed as previously described [15] (link). HCV antibodies were investigated by a third generation enzyme-linked immunosorbent assay (ELISA) (Ortho Diagnostic System Inc., Raritan, NJ) and confirmed by Western blot analysis (Innogenetics, Zwijndrecht, Belgium). IFNL3 rs12979860 SNP genotyping was performed using Allelic Discrimination assays from Applied Biosystems following the instructions of the manufacturer. Genotyping was performed using Taqman custom-designed primers and probes as follows: forward primer GCCTGTCGTGTACTGAACCA, reverse primer GCGCGGAGTGCAATTCAAC, and probes TGGTTCGCGCCTTC (VIC) and CTGGTTCACGCCTTC (FAM) (Applied Biosystems). Before performing the PCR reactions DNA is added with Allelic Discrimination Assay Mix and TaqMan Universal PCR Master Mix to MicroAmp Optical 96-Well Reaction Plates (Applied Biosystems). Real-Time PCR reactions were performed using the 7500 Fast Real-Time PCR System. After preheating for 10 min. at 92°C, 40 cycles of 15 seconds at 95°C and one minute at 60°C followed. Data were analyzed using the ABI SDS software (Applied Biosystems).

Briefly, 2 µg of total RNA were treated with RNase-free DNase I (Promega) and reverse transcribed using the iScript kit (Bio-Rad, Irvine, CA, USA) according to the manufacturer`s instructions. Two µl of cDNA served as a template in a 20 µl qPCR reaction mix containing the primers and SYBR Green PCR Master Mix (Diagenode, Seraing, Belgium). Quantification of gene expression was performed using the ABI PRISM^® 7000 SD RT-PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). A relative standard curve was constructed with serial dilutions (1:1, 1:10, 1:100) using a pool of the cDNA generated from all animals used in the study. The amplification program consisted of 1 cycle of 95°C for 10 min, followed by 45 cycles of 95°C for 15 sec, annealing for 10 sec, and 72°C for 30 sec. The fluorescent intensity was measured at a specific acquisition temperature for each gene. Data were extracted and amplification plots generated with ABI SDS software (Applied Biosystems, Thermo Fisher Scientific). All amplifications were performed in duplicate, and C_t scores were averaged for subsequent calculations of relative expression values. The level of individual mRNA was normalized to the level of the housekeeping gene cyclophilin by using the Pfaffl method (42 (link)). Exon-specific primers (Table S1) were designed by the Primer 3 program (43 (link)).

The RT² Profiler PCR Arrays PAHS-30C (SA Biosciences, MD, USA) was designed to analyze 84 genes related to human insulin signaling pathway. The RT-PCR was carried out using an ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). HT-29 cells were treated for 24 h with insulin (10⁻⁷ M). Total RNA (1 µg) was used as template to synthesize cDNA with the RT² First Strand kit (SABiosciences). The PCR cycle condition was as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 60 s. At the end of PCR cycling steps, data for each sample were displayed as a melting curve. The ABI SDS software (Applied Biosystems) was used to determine a critical threshold (Ct), which was the cycle number where the linear phase for each sample crossed the threshold level. Beta-2-microglobulin was used as housekeeping gene. The expression of HSD11B2 for the 3 experiments concerned was monitored in parallel by real time PCR which confirming significant downregulation by insulin. Records were deposed in the GEO data base with accession number GSE51677.

Genomic DNA for molecular analysis was extracted from buccal cells [12 (link)]. Sixty single-nucleotide polymorphisms (SNPs) were selected and are listed in Table 2. These SNPs were chosen based on their locations relative to the genes and results of previous association studies with dental caries [1 (link),2 (link),3 (link),4 (link),13 (link),14 (link),15 (link),16 (link)]. Polymerase chain reactions with TaqMan SNP Genotyping Assays from Applied Biosystems (Valencia, CA, USA), with a total volume of 3 µl per reaction and 3.0 ng of DNA per reaction, were used for genotyping all selected markers in a Tetrad PTC225 thermocycler from MJ Research (Waltham, MA, USA). Genotype detection and analysis were performed using the ABI 7900HT with ABI SDS software (Applied Biosystems, Valencia, CA, USA) [1 (link)].