Wizard sv gel and the pcr clean up system

A DNase I footprinting assay was performed according to Zianni et al. (25 (link)). For preparation of fluorescent 6-carboxyfluorescein (FAM)-labeled probes, the promoter fragments of P_AOX1 were amplified from the plasmid pMD19T inserted with specific promoter fragments of P_AOX1 using primers M13F-47 (FAM-labeled) and M13R-48 (supplemental Table S3). The FAM-labeled probes were purified using Wizard® SV Gel and the PCR Clean-up System (Promega) and were quantified with NanoDrop 2000c (Thermo Scientific). For each assay, 350-ng probes were incubated with different amounts of Mit1 (aa 1–150) or Prm1 (aa 41–90) in a total volume of 40 μl. After incubation for 30 min at 25 °C, 10 μl of solution containing about 0.015 unit of DNase I (Promega) and 100 nmol of freshly prepared CaCl₂ was added and further incubated for 1 min at 25 °C. The reaction was stopped by adding 140 μl of DNase I stop solution (200 mm unbuffered sodium acetate, 30 mm EDTA, and 0.15% SDS). Samples were first extracted with phenol/chloroform and then precipitated with ethanol, and the pellets were dissolved in 30 μl of MiniQ water. The preparation of the DNA ladder, electrophoresis, and data analysis were the same as described previously (25 (link)), except that the GeneScan-500 LIZ size standard (Applied Biosystems) was used.

The CRISPR-sgRNA target site was amplified by a high-fidelity PCR reaction from genomic DNA and purified by Wizard SV Gel and the PCR Clean up System (Promega). The primer sequences for PCR are shown in Supplementary Table 5. Purified PCR products (400 ng) were denatured (95 °C for 5 min) and re-annealed by gradually cooling from 95 °C to 85 °C at −2 °C/sec and 85 °C to 25 °C at −0.1 °C/sec in NEBuffer 2 (NEB) using a programmable thermocycler. The re-annealed PCR product was digested by 10 units of T7 endonuclease I (T7EI, NEB, Cat. No. M0302L) for 15 minutes at 37 °C. The reaction was stopped by the addition of 0.25 M EDTA solution, and the sample was placed on ice. The PCR products were analyzed on 2% agarose gel to quantify the intensity of the digested and undigested bands by ImageJ software or on High Sensitivity D1000 ScreenTape with TapeStation 2200 (Agilent Technologies). The percentage of nuclease-specific cleavage peak area in the summed band area (expressed as the fraction cleaved) was used to estimate the gene editing levels using the following equation^{35 (link)}, % mutation = 100 × (1 − (1 − f)^1/2), where f is the fraction cleaved.

A DNase I footprinting assay was performed following a method described previously [13 (link),18 (link)]. DNA fragments containing the perR promoter region were PCR amplified using a ³²P-labeled primer perR_FP_F: AGCCTTGCAAGAAATGAATAATAATGC and an unlabeled primer perR_FP_R: ATTCATCAATATTAGGATGCTCATGTC, and were purified from the agarose gel with Wizard SV Gel and the PCR Clean-Up System (Promega). Binding of rCosR to the ³²P-labeled perR promoter was performed at 37 °C for 10 min in 40 μL of the gel-shift assay buffer (20 mM HEPES (pH7.6), 1 mM EDTA, 10 mM (NH₄)₂SO₄, 5 mM DTT, 0.2% Tween 20, 30 mM KCl, 0.1 μg poly (dI-dC)) containing 10 mM of MgCl₂. After treatment of the reaction mixture with or without 0.1 U DNase I (Takara), the reactions were stopped by the addition of 200 μL of ice-cold stop solution (0.4 M NaOAc, 2.5 mM EDTA), and the DNA products were purified by phenol extraction and ethanol precipitation. The digested DNA fragments were separated by electrophoresis in 6% polyacrylamide-8 M urea gels alongside sequencing ladders that were generated with the same ³²P-labeled primer used to amplify DNA fragments for DNase I digestion.