A bovine MEN1–3′‐UTR was fused to a luciferase gene within the pMIR‐REPORT expression plasmid (Ambion Life Technologies, Grand Island, NY; referred to as pMIR‐REPORT‐bMEN1–3′‐UTR). The 789 bp fragment of MEN1 3′‐UTR was amplified from MEN1 cDNA using the forward primer 5′‐GCCACTAGTAGTACCGGGACTCCATATC‐3′ and the reverse primer 5′‐GCCAAGCTTACAAAATGTATTCATCTTCCT‐3′ (Sang Biotech, Shanghai, China). The bovine MAC‐T were transfected with 300 ng of pMIR‐REPORT‐bMEN1–3′‐UTR in combination with 50 nM mimics or 100 nM inhibitor specific to bta‐miR‐24‐3p, or the corresponding NCs (mimics NC or inhibitor NC) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. pMIR‐REPORT β‐gal (25 ng/well; Ambion), a beta‐galactosidase reporter plasmid, was simultaneously transfected for each well to provide the internal normalization of transfection. Luciferase assays were performed at 48 hr after transfection using the Luciferase Assay System (Promega, Madison, WI) and β‐Galactosidase Enzyme Assay System with reporter lysis buffer (Promega). Each transfection was assayed in triplicate. All of the experiments were performed three times for each transfection.
β galactosidase enzyme assay system with reporter lysis buffer
Manufactured by Promega
Sourced in United States
The β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer is a laboratory equipment product that provides a method for quantifying β-galactosidase enzyme activity. The product includes a reporter lysis buffer that facilitates the extraction and lysis of cells to release the β-galactosidase enzyme.
Automatically generated - may contain errors
Lab products found in correlation
Luciferase assay system, by Promega (2 mentions)
Luciferase reporter assay kit, by Abcam (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Penicillin, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Hepa 1c1c7, by Korean Cell Line Bank (1 mentions)
Hiv 1 p24 elisa kit, by PerkinElmer (1 mentions)
Dulbecco modified eagle medium (dmem), by Merck Group (1 mentions)
β galactosidase, by Thermo Fisher Scientific (1 mentions)
9 protocols using β galactosidase enzyme assay system with reporter lysis buffer
1
Bovine MEN1 3'-UTR Luciferase Assay
2
Transfection and Luciferase Assay for HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVECs (7.5×105 cells) were cotransfected with 2 µg of pGL3–3kBpro, 0.5 µg of pTKβ-Gal and either the control or FAM5C siRNAs by an electroporation method with Amaxa Nucleofector Kits for HUVEC (Lonza), and then were plated in a well of 6-well plates. At 6 hours after transfection, the cells were washed and the medium was changed. The cells were cultured for the following 48 hours, and then incubated with 10 ng/ml TNF-α for the last 6 hours. The cells were lysed with 100 µl of reporter lysis buffer, and the luciferase activities were determined with Pikka Gene (Toyo Ink, Japan) and a luminometer (BioOrbit 1253 or Luminoskan Ascent). β-Galactosidase activities were measured using β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer (Promega) according to the manufacturer's instructions. The luciferase activity was normalized by the β-galactosidase activity.
3
Normalizing Luciferase Activity Using Beta-Galactosidase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Activity of the beta-Galactosidase encoded by the control vector was measured to correct for transfection efficiency. For this, the β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer (Promega) was used according to the manufacturer’s instructions.
Luciferase activity values were then divided by the respective beta-Galactosidase activity values and subsequently normalized to the value obtained after transfection with the miRNA control mimic.
Luciferase activity values were then divided by the respective beta-Galactosidase activity values and subsequently normalized to the value obtained after transfection with the miRNA control mimic.
4
Antiviral Assay for Compound Screening
5
Monitoring YAP Transcriptional Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
YAP transcriptional activity was monitored via a luciferase reporter assay approach [35 (link)]. Briefly, Lipofectamine 3000 was used to transfect MDA-MB-231 cells with the 8xGTIIC-luciferase (Plasmid #34615) and β-gal plasmids (Ambion, USA). A Luciferase Reporter assay kit (BioVision, Inc., K801-200) was then used to monitor luciferase activity within these cells, while a β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer (Promega Corporation, E2000) was used based upon provided instructions to assess β-gal activity.
6
Transient HBV Transfection in Hepatoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human hepatocellular carcinoma HepG2 cells and mouse hepatoma Hepa-1c1c7 purchased from the Korean Cell Line Bank (KCLB, Seoul, South Korea) were grown in minimum essential medium (MEM) supplemented with 10% fetal bovine serum (FBS), 100 μg/ml of penicillin-streptomycin, and 25 mM HEPES at 37°C in a humidified environment containing 5% CO2. pHBV-1.2x containing genotype C HBV full-length genome (2.5 μg) was transiently transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). To normalize the transfection efficacy, pSV-β-Galactosidase (0.25 μg) was co-transfected, and the enzyme assay was accompanied using β-Galactosidase Enzyme Assay System with Reporter Lysis buffer (Promega, Madison, WI, USA), following the manufacturers' protocol.
7
Cytokine and HIV-1 Detection Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cytokine levels were measured in cell culture growth medium by ELISA, performed according to the manufacturer’s instructions. We used the following ELISA kits: human CXCL10/IP-10 and CXCL9/MIG DuoSet® ELISA Development System (R&D Systems, Minneapolis, MN), Human IFN Beta ELISA Kit (PBL Biomedical Laboratories, Piscataway, NJ) and Human Interferon-β ELISA Kit (TFB, Inc., Tokyo, Japan). The p24 concentration of the amplified HIV-1 virus was measured with HIV-1 p24 ELISA kit (PerkinElmer™ Life Sciences, Inc., Boston, MA). LTR transactivation in HeLa-CD4-LTR-β-gal cells was measured with β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer (Promega, Madison, WI).
8
AhR Transcriptional Activity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On day 0, Huh-7 cells (3 or 5 × 10 3 cells/well) were seeded in a 96-well plate containing Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich, St. Louis, MO, US) supplemented with 10 mM HEPES (pH 7.4), 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Waltham, MA, US), 100 units/mL penicillin, and 100 µg/mL streptomycin sulfate (PS; Thermo Fisher Scientific). On day 1, the cells were cotransfected with 20 ng/well XRE-Fluc (a reporter plasmid carrying the binding element of AhR upstream of the firefly luciferase), 45 ng/well pSV-β-Gal (a reporter plasmid carrying SV40 promoter upstream of the β-galactosidase) along with expression plasmids for 2.5 ng/well AhR and 2.5 ng/well Arnt, using 0.2 µL/well Lipofectamine 2000 reagent (Thermo Fisher Scientific). After incubation for 6 h, the cells were treated with the compounds (6.25 µg/mL) in the presence of 5 nM TCDD (Fujifilm Wako Pure Chemical Corporation, Tokyo, Japan.). After 22-24 h of incubation, the cells in each well were lysed, and the firefly luciferase activity and β-galactosidase activity were measured using a Luciferase Assay System (Promega, Madison, Wisconsin, US) and β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer (Promega). All luciferase assay data were normalized to β-galactosidase level.
9
Measuring YAP Transcriptional Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Luciferase reporter assay was performed to measure YAP transcriptional activity via detecting the luciferase activity of 8xGTIIC-luciferase plasmid, which is a YAP-responsive synthetic promoter driving luciferase expression plasmid. Briefly, 8xGTIIC-luciferase plasmid was co-transfected into HCC cells with β-Galactosidase (Ambion, Thermo Fisher Scientific) plasmid using Lipofectamine™ 2000 followed for 72 hours. After that, the luciferase activity of 8xGTIIC-luciferase plasmid was measured using a Luciferase Reporter Assay Kit (Cat # K801-200; BioVision, Inc., Milpitas, CA, USA). β-gal activity was determined using a β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer (Cat # E2000; Promega Corporation, WI, USA) following the manufacturer’s protocols, which was used as a normalization control for luciferase activity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!