Mir 30a 5p mimic

Cells at the density of 5 × 10⁴/well were inoculated into 24‐well plates, with the culture medium free from antibiotics. When cells grew to 70% confluence, pcDNA‐XIST (Genechem, Shanghai, China), si‐XIST‐1 (sense: 5′‐GCAAAUGAAAGCUACCAAU‐3′, antisense: 5′‐AUUGGUAGCUUUCAUUUGC‐3′, Genechem, Shanghai, China), si‐XIST‐2 (sense: 5′‐GCACAAUAUCUUUGAACUA‐3′, antisense: 5′‐UAGUUCAAAGAUAUUGUGC‐3′, Genechem, Shanghai, China), si‐XIST‐3 (sense: 5′‐CUAGAAUCCUAAAGGCAAA3′, antisense: 5′UUUGCCUUUAGGAUUCUAG3′, Genechem, Shanghai, China), miR‐30a‐5p mimic (sense: 5′‐UGUAAACAUCCUCGACUGGAAG‐3′, antisense: 5′‐CUUCCAGUCGAGGAUGUUUACA‐3′, Ribobio, Guangzhou, China), miR‐30a‐5p inhibitor (sense: 5′‐CUUCCAGUCGAGGAUGUUUACA‐3′, anti‐sense: 5′‐UGUAAACAUCCUCGACUGGAAG‐3′, Ribobio, Guangzhou, China), pCMV6‐ROR1 (OriGene Technologies, Rockville, MD, USA), and si‐ROR1 (sense: 5′‐AUCCGGAUUGGAAUUCCCAUG‐3′, antisense: 5′‐CAUGGGAAUUCCAAUCCGGAU‐3′; sense: 5′‐CUUUACUAGGAGACGCCAAUA‐3′, anti‐sense: 5′‐UAUUGGCGUCUCCUAGUAAAG‐3′, Open Biosystem, Huntsville, AL, USA) were transfected into Lovo cells, according to the instructions of Lipofectamine3000 (Invitrogen, Carlsbad, CA, USA).

The gene-overexpression vectors (pcDNA-NORAD and pcDNA-RAB11A) and the control vector (pcDNA) were purchased from GenScript Biotech Corp. (Nanjing, China). The small interfering RNAs against NORAD (NORAD siRNA), RAB11A (RAB11A siRNA) and negative control siRNAs (NC siRNAs) were designed, synthesized and validated by Thermo Fisher Scientific (Waltham, MA, USA). MiR-30a-5p mimic, miR-30a-5p inhibitor and the corresponding negative control (NC mimic and NC inhibitor) were purchased from RiboBio (Guangzhou, China). All these plasmids and oligonucleotides were transfected into PC-3 or LNCap cells by using lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, USA) under the suggestion of the manufacturer. At 48 h after transfection, cells were harvested for further study.

The lentiviral vector pLVX-3×Flag-Puro was used to clone the cDNA of human CLCF1 to obtain the pLVX-CLCF1-3×Flag-Puro plasmid. The pmirGLO dual-luciferase reporter from Promega was used to clone the human CLCF1 3′-UTR to obtain the wild-type pmirGLO-CLCF1-3′-UTR reporter. In the mutant reporter pmirGLO-CLCF1-3′-UTR-mut, mutations of seven nucleotides in the CLCF1 3′-UTR that correspond to the miR-30a-5p seed sequences were performed. DNA sequencing was performed to confirm all constructs. The agomiR-30a-5p, miR-30a-5p mimics, CLCF1 siRNA and their respective control RNAs and anti-miR-30a-5p reagents were procured (RiboBio, China).