Abi7000 sequence detector

Sequences of all primers used are provided within the Supplemental Methods.
Whole hearts were homogenized in Trizol reagent (Invitrogen) at a volume of 1 ml/50–100 mg tissue and RNA was extracted, according to the manufacturer’s instructions. Total RNA was quantified using a Nanodrop (Thermo Fisher Scientific). Reverse transcription was performed using 0.5 μl 500 μg/ml random primers and Superscript II Reverse Transcriptase (Invitrogen). qPCR analysis was performed on an ABI 7000 Sequence Detector using SYBR Green (Applied Biosystems). Data were normalized to Hprt1, and relative expression was calculated using the ΔΔC_t method (60 (link)). For epicardial genes, fold change from baseline to day 2 is highly underestimated in our analysis, as epicardial markers are barely expressed in the uninjured adult heart and cycle threshold (C_t) values from those times points were too high to accurately derive expression level; therefore, fold change is shown relative to day 2 values. The extent of reactivation and marker reexpression is better demonstrated at the protein level by immunofluorescence; however, qPCR is included to quantitate temporal changes between day 2 and day 21.

Real-time quantitative reverse transcription-PCR (qRT-PCR) was done with the ABI 7000 Sequence Detector (Applied Biosystems). We used ready-made TaqMan® assays on the analyzed genes and custom-designed GAPDH primers and TaqMan® probe [52 (link)] (Applied Biosystems). Reactions for qRT-PCR were done with the TaqMan® universal PCR Master Mix kit (Applied Biosystems) in 96-well plates. Each sample was measured in triplicate. PCR was run using the following conditions: an initial denaturation step of 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. The resulting data were analyzed with ABI Prism 7000 SDS software (Applied Biosystems). The threshold cycles (CT) were determined, and the differences in the CT values for GAPDH and selected genes were calculated.

RT-QPCR method was modified from a previously published work [23 ]. Briefly, total RNA was extracted using TRIzol reagent (Invitrogen). Complementary DNA (cDNA) was then synthesized using a cDNA synthesis kit (Thermo Fisher Scientific). The quantitative reactions were done using SYBR Premix Ex Taq II (Takara, Tokyo, Japan). An ABI7000 sequence detector (Applied Biosystems, Foster City, CA, USA) was used to get the Ct values and read the fluorescence intensities. The fold-change results calculated using $2^{-\mathrm{\Delta }\mathrm{\Delta }Ct}$ method were presented. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was the reference gene. Primer sequences for GAPDH are: CTGGGCTACACTGAGCACC (forward), and AAGTGGTCGTTGAGGGCAATG (reverse). Primer sequences for ZNF267 are as follows: AGTATGGGTGATAGAGAAAGATTT (forward), and ACCATTCTTAAACTCAATACTCATC (reverse).