RNA was extracted from swabs and BAL using the QiaAmp Viral RNA kit (Qiagen) according to the manufacturer’s instructions. Tissues (30 mg) were homogenized in RLT buffer and RNA was extracted using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. For detection of viral RNA, 5 μl RNA was used in a one-step real-time RT-PCR E assay33 (link) using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of counted RNA standards were run in parallel, to calculate copy numbers in the samples. For detection of SARS-CoV-2 mRNA, primers targeting open reading frame 7 (ORF7) were designed as follows: forward primer 5’-TCCCAGGTAACAAACCAACC-3’, reverse primer 5’-GCTCACAAGTAGCGAGTGTTAT-3’, and probe FAM-ZEN-CTTGTAGATCTGTTCTCTAAACGAAC-IBFQ. 5 μl RNA was used in a one-step real-time RT-PCR using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of counted RNA standards were run in parallel, to calculate copy numbers in the samples.
Rotor gene probe kit
Manufactured by Qiagen
The Rotor-Gene probe kit is a laboratory equipment product designed for real-time PCR analysis. It provides the necessary components to perform quantitative analysis of nucleic acid targets using probe-based detection.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp viral rna kit, by Qiagen (28 mentions)
Rneasy kit, by Qiagen (27 mentions)
Qiaamp viral rna mini kit, by Qiagen (4 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Qiacube ht automated system, by Qiagen (2 mentions)
Rneasy method, by Qiagen (2 mentions)
Rlt buffer, by Qiagen (1 mentions)
Droplet digital pcr, by Bio-Rad (1 mentions)
Qiaamp viral rna extraction kit, by Qiagen (1 mentions)
Nucleospin 96 virus core kit, by Macherey-Nagel (1 mentions)
Qiaxtractor, by Qiagen (1 mentions)
44 protocols using rotor gene probe kit
1
SARS-CoV-2 RNA Detection Protocols
2
SARS-CoV-2 RNA Detection Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from swabs and bronchoalveolar lavage using the QiaAmp Viral RNA kit (Qiagen) according to the manufacturer’s instructions and as described7 (link). 5 μl RNA was used in a one-step real-time RT–PCR E assay using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of counted RNA standards were run in parallel, to calculate copy numbers in the samples. For detection of SARS-CoV-2 mRNA, primers targeting open reading frame 7 (ORF7) were designed as follows: forward primer 5′-TCCCAGGTAACAAACCAACC-3′, reverse primer 5′-GCTCACAAGTAGCGAGTGTTAT-3′, and probe FAM-ZEN-CTTGTAGATCTGTTCTCTAAACGAAC-IBFQ. Five μl RNA was used in a one-step real-time RT–PCR using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of counted RNA standards were run in parallel, to calculate copy numbers in the samples. Detection of viral E gene subgenomic mRNA (sgRNA) was performed using RT-PCR as described9 (link). The forward primer was 5’−3’ CGATCTCTTGTAGATCTGTTCTC, the reverse primer was ATATTGCAGCAGTACGCACACA and the probe was FAM-ACACTAGCCATCCTTACTGCGCTTCG-ZEN-IBHQ.
3
SARS-CoV-2 RNA Detection Protocol
4
SARS-CoV-2 RNA Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from swabs and BAL using the QiaAmp Viral RNA kit (Qiagen) according to the manufacturer’s instructions. Tissues (30 mg) were homogenized in RLT buffer and RNA was extracted using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. For detection of viral RNA, 5 μl RNA was used in a one-step real-time RT-PCR E assay29 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of counted RNA standards were run in parallel, to calculate copy numbers in the samples. For detection of SARS-CoV-2 mRNA, primers targeting open reading frame 7 (ORF7) were designed as follows: forward primer 5’-TCCCAGGTAACAAACCAACC-3’, reverse primer 5’-GCTCACAAGTAGCGAGTGTTAT-3’, and probe FAM-ZEN-CTTGTAGATCTGTTCTCTAAACGAAC-IBFQ. 5 μl RNA was used in a one-step real-time RT-PCR using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of counted RNA standards were run in parallel, to calculate copy numbers in the samples.
5
SARS-CoV-2 RNA Detection by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from swabs and bronchoalveolar lavage specimens using the QIAamp viral RNA kit (Qiagen) according to the manufacturer’s instructions and as described elsewhere (13 (link)). Five microliters of RNA was used in a one-step real-time reverse transcription-PCR (RT-PCR) E assay using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of counted RNA standards were run in parallel, to calculate copy numbers in the samples. For detection of SARS-CoV-2 mRNA, primers targeting open reading frame 7 (ORF7) were designed as follows: forward primer, 5′-TCCCAGGTAACAAACCAACC -3′; reverse primer, 5′-GCTCACAAGTAGCGAGTGTTAT -3′; and probe, 6-carboxyfluorescein (FAM)-ZEN-CTTGTAGATCTGTTCTCTAAACGAAC -Iowa black fluorescent quencher (IBFQ). Five microliters of RNA was used in a one-step real-time RT-PCR using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of counted RNA standards were run in parallel, to calculate copy numbers in the samples. Detection of viral E gene subgenomic mRNA (sgRNA) was performed using RT-PCR as described elsewhere (15 (link)). The forward primer (5′–3′) was CGATCTCTTGTAGATCTGTTCTC , the reverse primer was ATATTGCAGCAGTACGCACACA , and the probe was FAM-ACACTAGCCATCCTTACTGCGCTTCG -ZEN-Iowa black hole quencher (IBHQ).
6
SARS-CoV-2 RNA Detection by RT-PCR
7
RNA Extraction and qRT-PCR Detection of Nipah Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from swab samples in DMEM and from EDTA blood samples using the QIAamp viral RNA mini kit (Qiagen) according to the manufacturer’s instructions. RNA was extracted from tissues using the RNeasy kit (Qiagen); tissues (30 mg) were homogenized in RLT buffer (Qiagen), and RNA was extracted according to the manufacturer’s instructions. Moreover, 5 µL RNA was used in a one-step real-time RT-PCR targeting the N gene of NiV using the Rotor-Gene probe kit (Qiagen) according to the instructions of the manufacturer. In each run, dilutions of PCR standards with known copy numbers were run in parallel to calculate copy numbers in the samples. qRT-PCR assays and standards specific for NiV (Bangladesh) or VSV were used.
8
MERS-CoV RNA Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues (30 mg) were homogenized in RLT buffer, and RNA was extracted using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. RNA was extracted from BAL fluid using the QIAamp Viral RNA kit (Qiagen) on the QIAxtractor. The UpE MERS-CoV (36 (link)) or mRNA (37 ) detection assay was used for the detection of MERS-CoV viral RNA. Five microliters of RNA was tested with the Rotor-Gene probe kit (Qiagen) according to the instructions of the manufacturer. Dilutions of MERS-CoV virus stock with known genome copies were run in parallel. Genome copies were determined using Droplet Digital PCR (Bio-Rad) and the corresponding qRT-PCR.
9
SARS-CoV-2 RNA Extraction and Detection
10
SARS-CoV-2 RNA Detection by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from swabs using the QIAamp Viral RNA kit (Qiagen) according to the manufacturer’s instructions. Tissues were homogenized in RLT buffer and RNA was extracted using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. For detection of viral RNA, 5 µl RNA was used in a one-step real-time RT-PCR against the N gene which detects genomic and subgenomic RNA17 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer. In each run, standard dilutions of RNA standards counted by droplet digital PCR were run in parallel, to calculate copy numbers in the samples. A complete list of primers is shown in Supplementary Table 4 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!