The largest database of trusted experimental protocols

12 protocols using mir 93 5p mimic

1

HGF Regulation and miR-93-5p Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HGF overexpression (OE) vector (OE-HGF), HGF small interfering RNA (si; si-HGF), miR-93-5p mimic, miR-93-5p inhibitor and their corresponding negative controls (NCs) were purchased from Shanghai GenePharma Co., Ltd. (Table SI). pcDNA3.1 empty vector was used as the NC for OE-HGF. HepG2 cells were seeded (2×104 cells/well) into a 6-well plate. Subsequently, cells were transfected with OE-HGF (2.5 µg), si-HGF (2.5 µg), miR-93-5p mimic (50 nM), miR-93-5p inhibitor (50 nM) or the corresponding NCs (50 nM) using Lipofectamine® 3000 Transfection Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C for 48 h. The transfection efficiency and the subsequent assays were performed 48 h after transfection. Cells in the NC group were transfected with mimic-NC and inhibitor-NC, or empty vector and si-NC due to the similar transfection efficiency of their NC (Figs. S1 and S2).
+ Open protocol
+ Expand
2

Transfection of miRNA Mimics

Check if the same lab product or an alternative is used in the 5 most similar protocols
The miR-NC and miR-93-5p mimic were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). miRNA were transfected with Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) when the density is about 50%.
+ Open protocol
+ Expand
3

Overexpression of miR-93-5p, TLR4, and Atg7

Check if the same lab product or an alternative is used in the 5 most similar protocols
For miR-93-5p overexpression, the miR-93-5p mimic or corresponding NC (miR-NC) was purchased from GenePharma (Shanghai, China). Human umbilical vein endothelial cells (HUVECs) were transfected with either the miR-93-5p mimic or miR-NC at a final concentration of 50 nM using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. The cells were then used for miR-93-5p expression analyses or for other experiments after 48 hr of transfection.
For the overexpression of TLR4 and Atg7, TLR4 and Atg7 cDNA with the 3′ UTR were cloned into the pMSCV-hygro vector. The primers corresponded to the National Center for Biotechnology Information reference sequence and were as follows: TLR4 (forward, 5′-CAGAGCTCGGAGTACAAAACTC-3′ and reverse, 5′-GGTCTAGAAAAGTGCTTTTTGCAAG-3′); Atg7 (forward, 5′-CAGAGCTCGTGCCTCATTGGGTC-3′ and reverse, 5′-GGTCTAGACAGTAATAAAGTGC-3′). The TLR4 or Atg7 cDNA was inserted into the pMD18-T Simple Vector (Takara, Otsu, Japan) to form the pMD18-T-TLR4 and pMD18-T-Atg7 vectors, respectively. Following sequencing, the recombinant segment of the correct clone was incised by BamHI and XbaI (Takara). The recombinant segment was inserted into pMSCV-hygro, which was incised by the same two restriction endonucleases. The clones were sequenced, and the correct clones were amplified and identified before transfection into H9c2 cells.
+ Open protocol
+ Expand
4

SUMO1P3 siRNA and miR-93-5p Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
PcDNA3.1-SUMO1P3 (SUMO1P3) (5'-CAAUCAACUCUGAGAUCATT-3'), SUMO1P3 (si-SUMO1P3) siRNA, miR-93-5p mimic (Hsa-miR-93-5p:5'-UAGCAG-CACGUAAAUAUUGGCG-3'), miR-93-5p agomir, si-Bin1 (5'-UAGCAGCACAUAAUGGUUUGUG-3') and their corresponding controls (GenePharma, Shanghai, China) were synthesized by GenePharma (Shanghai China). Oligonucleotides were transfected into the cells by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).
+ Open protocol
+ Expand
5

Adenovirus-Mediated SUMO1P3 Silencing in Rats

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant adenovirus containing mouse SUMO1P3 shRNA (Ad-SUMO1P3-shRNA), 7 days before DOX induction, adenovirus was intratracheally dripped into rats. Control adenovirus (Ad-GFP) was injected into the control group. MiR-93-5p mimic and its NC were purchased from GenePharma (Shanghai, China). 50 μg MiR-93-5p mimic or its negative control was dissolved in 50 μl of sterile double distilled water, and 50 μl of glucose solution was added. Then, the tail vein of rats was injected with 200 μ l working solution.
+ Open protocol
+ Expand
6

SUMO1P3 siRNA and miR-93-5p Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
PcDNA3.1-SUMO1P3 (SUMO1P3) (5'-CAAUCAACUCUGAGAUCATT-3'), SUMO1P3 (si-SUMO1P3) siRNA, miR-93-5p mimic (Hsa-miR-93-5p:5'-UAGCAG-CACGUAAAUAUUGGCG-3'), miR-93-5p agomir, si-Bin1 (5'-UAGCAGCACAUAAUGGUUUGUG-3') and their corresponding controls (GenePharma, Shanghai, China) were synthesized by GenePharma (Shanghai China). Oligonucleotides were transfected into the cells by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).
+ Open protocol
+ Expand
7

Adenovirus-Mediated SUMO1P3 Silencing in Rats

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant adenovirus containing mouse SUMO1P3 shRNA (Ad-SUMO1P3-shRNA), 7 days before DOX induction, adenovirus was intratracheally dripped into rats. Control adenovirus (Ad-GFP) was injected into the control group. MiR-93-5p mimic and its NC were purchased from GenePharma (Shanghai, China). 50 μg MiR-93-5p mimic or its negative control was dissolved in 50 μl of sterile double distilled water, and 50 μl of glucose solution was added. Then, the tail vein of rats was injected with 200 μ l working solution.
+ Open protocol
+ Expand
8

miRNA Transfection Optimization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The miR-NC and miR-93-5p mimic were purchased from Shanghai GenePharma Co., Ltd (Shanghai, China). miRNA were transfected with Lipofectamine 3000(Invitrogen, Carlsbad, CA, USA)when the density of the cell inoculation plate is about 50%.
+ Open protocol
+ Expand
9

Regulation of miR-93-5p and TLR4 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
For regulation of miR-93-5p expression level, miR-93-5p mimics, miR-93-5p inhibitors, NC mimics and NC inhibitors were designed and provided by GenePharma (Shanghai, China). To knock down or over expressed TLR4 expression, the siRNAs against TLR4 and over expressed TLR4 were obtained from Generalbio (Anhui, China) with nonspecific siRNAs and vector as negative control. The siRNAs sequences were as follows: miR-93-5p inhibitor, AGGTAGTGTGATTACCCAACCTACT; Si-TLR4, CACGGCATCTTTACTGGCTTAGTCA. Cells were plated to 6-well plates at 4 × 105 cells/well and transfected with the mentioned plasmids or oligonucleotides using Lipofectamine 3000 (Thermo Fisher Scientific, USA) obeying the manufacturer’s directions.
+ Open protocol
+ Expand
10

Regulating lncRNA MEG3 and miR-93-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell transfection was performed using Lipofectamine 2000 (Invitrogen, Canada). Recombinant lentiviral vector carrying lncRNA MEG3 or short hairpin RNAs (shRNA)-MEG3 were constructed to induce MEG3 up-regulation or down-regulation as previously described (12 (link)). The miR-93-5p mimics were obtained from Genepharma (Shanghai, China) to induce miR-93-5p up-regulation. BIU87 cells were transfected with lentiviral vector lncRNA MEG3 and/or miR-93-5p mimics, respectively. Untransfected cells were used as a blank control.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!