Log In Sign up
The largest database of trusted experimental protocols

Turner td20 20 luminometer

Manufactured by Turner Designs
Visit Supplier
Sourced in United States

The Turner TD20/20 luminometer is a compact and versatile instrument designed for the detection and measurement of luminescent signals. It provides accurate and reliable quantification of various luminescent-based assays, including bioluminescence and chemiluminescence.

Automatically generated - may contain errors

Lab products found in correlation

Luciferase assay system, by Promega (1 mentions) Pcmv myc, by Takara Bio (1 mentions) Hek 293 cells, by American Type Culture Collection (1 mentions) Fugene hd, by Promega (1 mentions) Bright glo lysis buffer, by Promega (1 mentions) Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions) Plus reagent, by Thermo Fisher Scientific (1 mentions) Passive lysis buffer (plb), by Promega (1 mentions)

Spelling variants of this product

Turner 20/20 luminometer (3 citations)

3 protocols using turner td20 20 luminometer

1

Transient Transfection of 293 Cells

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The 293 cells were cultured and transiently transfected with 0.3 µg reporter plasmids A2 (generous gift of Professor Trevor Williams) or pTOPFLASH (Clontech Laboratories, Inc.) (18 (link)) and the indicated plasmids (0.3 µg pCMV-Myc-KCTD1 and/or 0.3 µg of pCMV-Myc-AP-2α) in 12-well plates using Lipofectamine 2000 reagent as previously described (20 (link)). Briefly, 0.1 µg pCMV-LacZ plasmid (19 (link)) was co-transfected in each well to measure transfection efficiency as an internal β-galactosidase control. The total amount of 1 µg plasmid DNA in each well was maintained by adding empty vector pCMV-Myc (Clontech Laboratories, Inc.) to each transfection. β-galactosidase and luciferase activities were assessed 24 h after transfection using a Promega Luciferase Assay system (Promega Corporation) and a Turner TD20/20 luminometer (Turner Designs). The luciferase activity is normalized relative to the β-galactosidase control. A total of three experimental repeats were performed.
Hu L., Chen L., Yang L., Ye Z., Huang W., Li X., Liu Q., Qiu J, & Ding X. (2020). KCTD1 mutants in scalp-ear-nipple syndrome and AP-2α P59A in Char syndrome reciprocally abrogate their interactions, but can regulate Wnt/β-catenin signaling. Molecular Medicine Reports, 22(5), 3895-3903.
+ Open protocol
+ Expand
2

Luciferase Assay for Transfected Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
2 ×105 293 HEK cells (ATCC) were transfected with iE6E7 vector with or without PGK-Cre-bpA vector, a gift of Klaus Rajewski using Fugene HD (Promega). 48h later, cells were lysed in Bright Glo lysis buffer (Promega) for 20 min luciferase activity was assessed using a Turner TD 20/20 Luminometer (Turner Designs) and luciferase activity was normalized to protein concentration of the sample.
Zhong R., Pytynia M., Pelizzari C, & Spiotto M. (2014). Bioluminescent imaging of HPV-positive oral tumor growth and its response to image guided radiotherapy. Cancer research, 74(7), 2073-2081.
+ Open protocol
+ Expand
3

Analyzing NF-kB Promoter Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
The NF-kB promoter-luciferase vector was generated by inserting a 100-bp fragment comprising the mouse NF-kB promoter region into a pGM-lu vector. Astrocytes or HEK293T cells were transfected with the NF-kB promoter-luciferase vector together with dual reporter plasmid pRL-TK using Lipofectamine LTX and Plus Reagent (Invitrogen). Cell lysates were generated using a passive lysis buffer (PLB) (Promega). Firefly and Renilla luciferase activity was measured in cell lysates according to the manufacturer's instructions using a Dual Luciferase Assay System with a Turner TD-20/20 luminometer (Turner Designs, Sunnyvale, CA, USA). Relative firefly luciferase activity was calculated by normalizing transfection efficiency to Renilla luciferase activity. The mouse NF-kB promoter region comprised the following sequence: GGCCTAACTGGCCGGTACCGCTAGCCTCGATGGGAATTTCCGGGAATTTCCGG GAATTTCCGGAATTTCCGCGCGTAGATCTGCAGAAGCTTAGACACT
Leng L., Zhuang K., Liu Z., Huang C., Gao Y., Chen G., Lin H., Hu Y., Wu D., Shi M., Xie W., Sun H., Shao Z., Li H., Zhang K., Mo W., Huang T.Y., Xue M., Yuan Z., Zhang X., Bu G., Xu H., Xu Q, & Zhang J. (2018). Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation. Neuron, 100(3).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!