Topo cloning vector

Genomic DNA was extracted from cells using the DNeasy blood and tissue kit (Qiagen). Nectin1 deletion was confirmed by PCR amplification of the 5’ region of the NECTIN1 gene (Forward and reverse primers: GACTCAGCTGCGAGGGAGAAG and GAGCTGGCTTTCTCGATTGCC)., Amplicons were confirmed to be the correct size, purified and expanded in a Topo cloning vector (Invitrogen). Six KO and three KO2 clones were purified and sent for Sanger sequencing (Eurofins Genomics).

Genomic DNA was extracted from GIST-T1 and GIST882 cells using the DNeasyBlood&Tissue kit (Qiagen, Valencia, CA, USA). DNA bisulfate conversion was performed with the EZ DNA Methylation-Gold Kit™ (ZYMO Research, Irvine, CA, USA) followed by a MS-PCR. The following MS-PCR primers for PCDH10 were used as described: Methylation (forward: GTTAGGGAGGATGGATGTAAGTATC, reverse: GCG AAATAAAAACAATAAAACGAC) and; un-methylation (forward: GTTAGGGAG GATGGATGTAAGTATT, reverse: CCCACA AAATAA AAACAATAA AA AA) [9 (link)]. The amplified DNA was cloned into TOPO cloning vector (Invitrogen) and sequenced using DNAMAN software.

Total RNA or viral RNA from virus-containing culture supernatant was extracted using commercial kits (Qiagen, Valencia, CA) and reverse transcribed to cDNA SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA) using primer p7rev (CCCGACCCCTGATGTGCCAAGC). The envelope genes (E1E2) were amplified using the Expend High Fidelity PCR system (Roche Applied Sciences, Indianapolis, IN) and primers E1F (GGAACCTTCCTGGTTGCTCTTTCTCTATCTTCC) and E2R (TGCTTCGGCCTGGCCCAACAAGAT). The PCR products were ligated into the Topo cloning vector (Invitrogen, Carlsbad, CA), and individual clones containing an insert of the expected size were sequenced in both sense and antisense strands (Elim Biopharm, Hayward, CA). Selected PCR products were cloned into pCDNA 3.1 expression vector for protein production in binding assay.

Cas9 mRNA and gRNA were synthesized using mMESSAGE T7 ULTRA Transcription Kit (Invitrogen) and MEGAshortscript T7 Transcription Kit (Invitrogen), respectively. Genomic DNA was extracted with Qiagen DNAeasy kit. The PCR products were cloned into TOPO cloning vector (Invitrogen). Individual clones were sequenced with T7 primer (Supplementary Table 9).
Single-cell fertilized eggs were obtained by either natural or induced breeding and injected according to previously published protocols with modifications^{60 (link), 61 (link)}. Briefly, 500 pg Cas9 RNA and 100 pg gRNA were mixed into 5 nl and injected into freshly laid single-cell-stage embryos. The animals were raised according to^{60 (link)}. The screening of F₀ animals was done by both genotyping (see above) and phenotype characterization, including pigmentation analysis and immunohistochemistry of limbs/tails, according to^{39 (link), 40 (link)}. The Pax7^−/− and Tyr^−/− F1 animals were produced by crossing between adult F₀ animals. The larvae or post-metamorphic newts were anaesthetized within 0.01% or 0.1% ethyl-p-aminobenzoate (benzocaine; Sigma) prior to imaging and tissue collection. Newts utilized for this study were processed according to Swedish Board of Agriculture animal ethical regulations (N429/12).

NPY, CART, and pOX sequences were retrieved from GeneBank sequence database (NCBI) with accession number AY822596, DQ167209, and DQ486137, respectively. cDNA sequence fragments of NPY (346 bp), CART (300 bp), and pOX (453bp) were synthesized from total RNA extracted from cod brain, using oligo(dT)12-18 primer and Superscript III (Invitrogen, Carlsbad, CA, USA), by standard procedures. The primers used were: ggaactctgaccgagggat NPY(F) and gccctctgatgacaaatca NPY(R) for NPY; gagtgtggaccagagccttg CART(F) and gcagtcacacatcttcccaat CART(R) for CART; aatgaagtggtcctccacagtgt Orex(F) and tcaagcggtgaagtcttgctgc Orex(R) for pOX. PCR amplification was performed with an initial step of 94°C for 5 min, 30 cycles of 94°C for 25s, 55°C for 30s, 68°C for 90s and extension at 68°C for 7 min. PCR products were purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into TOPO cloning vector (Invitrogen). The inserts were sequenced at the University of Bergen Sequencing Facility, and used to synthesize antisense and sense (control) probes with digoxigenin (DIG RNA labeling mix, Roche Diagnostic) and fluorescein (Fluorescein RNA Labeling Mix, Roche Diagnostic) haptens for ISH methods.

Human LCN2 promoter fragments were PCR amplified from genomic DNA from HepG2 cells JumpStart RED Accutaq DNA Polymerase (Sigma Aldrich, Taufkirchen, Germany) and ligated into the pGL3 vector (Promega, Madison, WI, USA) via engineered restriction sites (KpnI, NcoI). For murine constructs, fragments of the Lcn2 promoter from genomic DNA of C57BL/6 mice were amplified by PCR using DREAMtaq polymerase (Thermo Fisher Scientific, Waltham, MA, USA). Primers used for amplification contained restriction sites for KpnI and HindIII flanking the promoter fragments. The PCR products were cloned into a TOPO cloning vector (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. The TOPO vectors containing the promoter fragments were subsequently digested using KpnI and HindIII (both from New England Biolabs, Ipswich, MA, USA), and the fragments were integrated into the pGL3 vector using T4 ligase (New England Biolabs, Ipswich, MA, USA). The primers used for amplification are listed in Table S5.