GelGreen Nucleic Acid Stain is a fluorescent dye used for the detection of nucleic acids, such as DNA and RNA, in agarose gels. It is designed to emit a green fluorescence signal upon binding to nucleic acid molecules. The dye can be used in various applications, including gel electrophoresis, nucleic acid quantification, and imaging.
Evidence of the oligonucleotide identity and purity was obtained by MALDI-TOF mass spectrometry and HPLC data, provided by the commercial suppliers. The purity of these oligonucleotides was further confirmed by denaturing 20% PAGE analysis. The 24-mer sequence (5′TCACACACACACACACACACACTT3′), used as negative oligonucleotide control in the MTT assays, was obtained as reported in previous works [63 (link),64 (link)]. Recombinant human VEGF165 (GenScript) was purchased from TwinHelix srl (Milan, Italy) and prepared according to the manufacturer’s instructions. Bovine serum albumin (BSA) was purchased from Thermo Scientific™ (Waltham, MA, USA).
Riccardi C., Musumeci D., Platella C., Gaglione R., Arciello A, & Montesarchio D. (2020). Tuning the Polymorphism of the Anti-VEGF G-rich V7t1 Aptamer by Covalent Dimeric Constructs. International Journal of Molecular Sciences, 21(6), 1963.
Riccardi C., D’Aria F., Fasano D., Digilio F.A., Carillo M.R., Amato J., De Rosa L., Paladino S., Melone M.A., Montesarchio D, & Giancola C. (2022). Truncated Analogues of a G-Quadruplex-Forming Aptamer Targeting Mutant Huntingtin: Shorter Is Better!. International Journal of Molecular Sciences, 23(20), 12412.
All the reagents and solvents were of the highest commercially available quality and were used as received. Nuclease-free water, acrylamide/bis-acrylamide (19:1) 40% solution, GelGreen Nucleic Acid Stain, 6X Orange DNA Loading Dye and Tris-Borate-EDTA (TBE) 10X were purchased from VWR. Formamide, urea, ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) were purchased from Sigma Aldrich. Fetal Bovine Serum (FBS) was provided by Euroclone. Among the oligonucleotides here studied, unmodified NU172 and NU were purchased from biomers.net GmbH (Germany) as HPLC-purified oligomers. Their quality was checked by HPLC and MALDI-TOF MS by the commercial suppliers. The cyclic NU172 analogues were synthesized and purified as described below. The purity of all the oligonucleotides was further confirmed by denaturing 20% PAGE analysis.
Riccardi C., Meyer A., Vasseur J.J., Cavasso D., Russo Krauss I., Paduano L., Morvan F, & Montesarchio D. (2020). Design, Synthesis and Characterization of Cyclic NU172 Analogues: A Biophysical and Biological Insight. International Journal of Molecular Sciences, 21(11), 3860.
The oligonucleotides R1.2, i.e. d(CACTGGGTGGGGTTAGCGGG CGATTTAGGGATCTTGAGTGGT), R1.3 i.e. d(CACTGGGTGGGGTTAGCGGG CGATTTAGGGATCTT), tel26 d[(TTAGGG)4TT], T35 and T42 oligonucleotides were purchased from Biomers (Germany). The oligomers identity and purity were proved by MALDI-TOF mass spectrometry and high performance liquid chromatography (HPLC) data, provided by the commercial supplier. The 3’-fluorescein-labeled aptamers were chemically synthesized by using FAM-labeled thymidine phosphoramidites as first monomers at the 3′-end using standard solid phase phosphoramidite chemistry, as previously reported.17 (link) Gel Green® Nucleic Acid Stain was purchased from VWR.
Moccia F., Platella C., Musumeci D., Batool S., Zumrut H., Bradshaw J., Mallikaratchy P, & Montesarchio D. (2019). The role of G-quadruplex structures of LIGS-generated aptamers R1.2 and R1.3 in IgM specific recognition. International journal of biological macromolecules, 133, 839-849.
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required