Gelgreen nucleic acid stain

All the reagents and solvents were of the highest commercially available quality and were used as received. Acrylamide, GelGreen Nucleic Acid Stain, Bromophenol blue (BPB), Gel Loading Buffer 4X, 6X Orange DNA Loading Dye and Tris-Borate-EDTA (TBE) 10X were purchased from VWR. Ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) were purchased from Sigma Aldrich. All the oligonucleotides here studied (Table 1) were purchased from biomers.net GmbH (Ulm, Germany), as HPLC-purified oligomers:▪

V7t1 (^5′TGTGGGGGTGGACGGGCCGGGTAGA^3′);

▪

bisV7t1T7 (^5′V7t1^3′TTTTTTT^5′V7t1^3′);

▪

bisV7t1HEG2 (^5′V7t1^3′C₂₄H₅₁O₂₀P₃^5′V7t1^3′);

▪

bisV7t1TEG2D (^5′V7t1^3′C₂₅H₅₃N₂O₂₄P₅^3′V7t1^5′).

Evidence of the oligonucleotide identity and purity was obtained by MALDI-TOF mass spectrometry and HPLC data, provided by the commercial suppliers. The purity of these oligonucleotides was further confirmed by denaturing 20% PAGE analysis.
The 24-mer sequence (^5′TCACACACACACACACACACACTT^3′), used as negative oligonucleotide control in the MTT assays, was obtained as reported in previous works [63 (link),64 (link)].
Recombinant human VEGF₁₆₅ (GenScript) was purchased from TwinHelix srl (Milan, Italy) and prepared according to the manufacturer’s instructions.
Bovine serum albumin (BSA) was purchased from Thermo Scientific™ (Waltham, MA, USA).

Acrylamide/bis-acrylamide (19:1) 40% solution, glycerol, formamide, urea, and GelGreen nucleic acid stain were purchased from VWR (Milan, Italy). Ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) were purchased from Sigma-Aldrich (Merck Life Science, Milan, Italy). Fetal bovine serum (FBS) was provided by Euroclone (Milan, Italy).

All the reagents and solvents were of the highest commercially available quality and were used as received. Nuclease-free water, acrylamide/bis-acrylamide (19:1) 40% solution, GelGreen Nucleic Acid Stain, 6X Orange DNA Loading Dye and Tris-Borate-EDTA (TBE) 10X were purchased from VWR. Formamide, urea, ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) were purchased from Sigma Aldrich. Fetal Bovine Serum (FBS) was provided by Euroclone.
Among the oligonucleotides here studied, unmodified NU172 and NU were purchased from biomers.net GmbH (Germany) as HPLC-purified oligomers. Their quality was checked by HPLC and MALDI-TOF MS by the commercial suppliers. The cyclic NU172 analogues were synthesized and purified as described below. The purity of all the oligonucleotides was further confirmed by denaturing 20% PAGE analysis.