Mastercycler nexus gradient thermal cycler

Manufactured by Eppendorf

Sourced in Germany

The Mastercycler Nexus Gradient thermal cycler is a laboratory instrument designed for performing polymerase chain reaction (PCR) experiments. It provides precise temperature control and a gradient function to optimize PCR conditions across multiple samples simultaneously.

Automatically generated - may contain errors

Lab products found in correlation

Gelcompare 2 software version 6, by bioMérieux (1 mentions) Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Taq dna polymerase, by New England Biolabs (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Superscript 3 first strand cdna synthesis system, by Thermo Fisher Scientific (1 mentions) Cfx96 real time pcr system, by Bio-Rad (1 mentions) Turbo dnase, by Thermo Fisher Scientific (1 mentions) Rnaeasy mini rna extraction kit, by Qiagen (1 mentions) Infinite 200 pro nanoquant, by Tecan (1 mentions) Las 3000, by Fujifilm (1 mentions) Kod fx dna polymerase, by Toyobo (1 mentions) Cfx96, by Bio-Rad (1 mentions) Accupower rt premix, by Bioneer (1 mentions) Sybr green premix, by Takara Bio (1 mentions) Fragment analyzer automated ce system, by Agilent Technologies (1 mentions) Quickgene mini80, by Fujifilm (1 mentions) 12 capillary array cartridge, by Agilent Technologies (1 mentions) Quickgene dna tissue kit s, by Fujifilm (1 mentions) Goldview 1 nucleic acid dye, by Solarbio (1 mentions) Es taq mastermix, by CWBIO (1 mentions)

Spelling variants of this product

Mastercycler Gradient (279 citations) Thermal cycler (211 citations) Mastercycler nexus (108 citations) Mastercycler Nexus Gradient (56 citations) Mastercycler Gradient thermal cycler (40 citations) Mastercycler thermal cycler (33 citations) Gradient thermal cycler (20 citations) Mastercycler Nexus Thermal Cycler (10 citations) Nexus Gradient (5 citations) Nexus thermal cycler (4 citations)

15 protocols using mastercycler nexus gradient thermal cycler

Molecular Identification of Acinetobacter baumannii Virulence Factors and Efflux Pumps

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genomic DNA of these isolates were extracted using the boiling method, as previously described.17 (link) The uniplex PCR assays were performed for the molecular identifications of the bap, pgaA, abaI, ompA and csuE genes and efflux pumps, including adeB, adeJ and adeG in a final volume of 25 μL.15 (link),24 (link) The sequences and sizes of the primers used in this study are shown in Table 1.
The amplification mixture consisted of 1U Taq DNA polymerase (Cinaclone, Iran), 1.5 mM MgCl₂, 200 μM dNTPs, 0.35 μM of each primer, 10x PCR buffer, 5 μL of template DNA and distilled water up to a final volume of 25 μL. The amplification process was performed in a Mastercycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany) with one cycle of initial denaturation at 94°C for 3 mins, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for the bap, ompA and csuE genes, 59°C for the abaI and ompA genes and 55°C for the adeB, adeJ and adeG genes for 30 s, extension at 72°C for 30 s, and a final extension cycle at 72°C for 10 mins. The PCR products were visualized on 2% agarose gel stained with safe stain.

Amin M., Navidifar T., Shooshtari F.S., Rashno M., Savari M., Jahangirmehr F, & Arshadi M. (2019). Association Between Biofilm Formation, Structure, and the Expression Levels of Genes Related to biofilm formation and Biofilm-Specific Resistance of Acinetobacter baumannii Strains Isolated from Burn Infection in Ahvaz, Iran. Infection and Drug Resistance, 12, 3867-3881.

+ Open protocol

+ Expand

Molecular Identification of Bacterial Pathogens

Check if the same lab product or an alternative is used in the 5 most similar protocols

The molecular identifications of the major bacterial pathogens were performed by the amplifications of species‐specific genes. The PCR targets were thelytA gene for S pneumoniae,8 the P1gene for H influenzae,10 the femA gene for S aureus,8 and the ecfX gene for P aeruginosa.11 The primer sets used for the identification of P aeruginosa, S pneumoniae, H influenzae, and S aureus and their annealing temperatures are listed in Table 1. The Uniplex PCRs for each target organism were prepared in a final volume of 20 μL. In all of these PCRs, the distilled water was used as the negative control. The amplification mixture consisted of 1U of Taq DNA polymerase, 1.5 mmol/L MgCl₂, 200 μmol/L dNTP, 0.4 μmol/L of each primer, 10x PCR buffer, 5 μL of template DNA, and distilled water up to a final volume of 20 μL. The amplification process was performed in a Mastercycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany) with one cycle of initial denaturation at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing temperatures following Table 1 and extension at 72°C for 60 seconds, with a final extension for 7 minutes at 72°C.8, 10, 11 The PCR products were visualized on 1% agarose gel stained with safe stain.

Amin M., Yousef pour S, & Navidifar T. (2019). Detection of the major bacterial pathogens among children suffering from empyema in Ahvaz city, Iran. Journal of Clinical Laboratory Analysis, 33(4), e22855.

+ Open protocol

+ Expand

Screening for Methicillin-Resistant Staphylococcus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Resistance to methicillin was detected by growth on agar screen plates (Mueller-Hinton agar) containing 6 μg/mL oxacillin with 4% NaCl. All plates were incubated at 35°C for 24 hours according to CLSI recommendations [10] . The presence of the mecA gene was evaluated in all 72 isolates by its amplification. Sequences of primers used for amplification of the mecA gene are listed in Table 1.Table 1

Primers used for determining SCCmec types

Name	Primer sequence (5′ to 3′)	Length (bp)	Target	SCCmec
Name	Primer sequence (5′ to 3′)	Length (bp)	Target	I	II	III	IV	V
β	F: ATTGCCTTGATAATAGCCYTCT	937	ccrA2-B		*		*
α3	R: TAAAGGCATCAATGCACAAACACT	937	ccrA2-B		*		*
ccrF	F: CGTCTATTACAAGATGTTAAGGATA	518	ccrC			*		*
ccrR	R: CCTTTATAGACTGGATTATTCAAAA	518	ccrC			*		*
1272F1	F: GCCACTCATAACATATGGAA	415	IS1272	*			*
1272R1	R: CATCCGAGTGAAACCCAAA	415	IS1272	*			*
5RmecA	F: TATACCAAACCCGACAACTAC	359	mecA-IS431					*
5R431	R: CGGCTACAGTGATAACATCC	359	mecA-IS431					*

The amplification process was performed by the MasterCycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany), with one cycle of initial denaturation at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing 52°C for 30 seconds, extension at 72°C for 45 seconds and a cycle of final extension at 72°C for 7 minutes. All PCR products were visualized on a 1% agarose gel stained with ethidium bromide.

Moosavian M., Shahin M., Navidifar T, & Torabipour M. (2017). Typing of staphylococcal cassette chromosome mec encoding methicillin resistance in Staphylococcus aureus isolates in Ahvaz, Iran. New Microbes and New Infections, 21, 90-94.

+ Open protocol

+ Expand

Genetic Profiling of Shigella Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genetic relationship of S. flexneri and S. sonnei isolates was evaluated by the enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) using primers of ERIC-F (5′-ATGTAAGCTCCTGGGGATTCAC-3′) and ERIC-R (5′AAGTAAGTGACTGGGGTGA GCG-3′).16 (link) The PCR reaction was performed in the final volume of 20 µ as follows: 1U Taq DNA polymerase, 1.5 mM MgCl₂, 200 μM dNTPs, 0.20 μM of each primer, 10x PCR buffer, 3 μL of template DNA and distilled water up to a final volume of 20 μL. The amplification process was performed in Mastercycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany) with one cycle of initial denaturation at 94°C for 5 mins, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 55°C for 60 s, extension at 72°C for 90 s, with a cycle of final extension at 72°C for 10 mins. The amplified products were resolved on agarose gel 1.5%, stained with ethidium bromide 0.5 µg/mL. The data analyses were performed using the Gel Compare II software version 6.6 (Applied Math, Sint-Martens-Latem, Belgium). The similarity pattern was calculated using the Unweighted-Pair Group Method/the Dice similarity coefficient with a position tolerance of 1.5%. Isolates with more than 90% similarity were considered an as clonal type.

Moosavian M., Ghaderiyan G.H., Shahin M, & Navidifar T. (2019). First investigation of the presence of SPATE genes in Shigella species isolated from children with diarrhea infection in Ahvaz, southwest Iran. Infection and Drug Resistance, 12, 795-804.

+ Open protocol

+ Expand

ERIC-PCR genotyping of A. baumannii

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genetic relationship of A. baumannii isolates was determined using the enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR)18 (link) with the primers sequences of ERIC-F (5′-ATGTAAGCTCCTGGGGATTCAC-3′) and ERIC-R (5′AAGTAAGTGACTGGGGTGA GCG-3′). The PCR reaction was performed in the final volume of 25 µL as follows: 1U Taq DNA polymerase, 1.5 mM MgCl₂, 200 μM dNTPs, 0.35 μM of each primer, 10x PCR buffer, 6.5 μL of template DNA and distilled water up to a final volume of 25 μL. The amplification process was performed in Mastercycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany) with one cycle of initial denaturation at 94°C for 5 mins, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 57°C for 60 s, extension at 72°C for 80 s and a cycle of final extension at 72°C for 10 mins. The amplified products were visualized on agarose gel 1.5%, stained with safe stain. The data analysis was performed using the Gel Compare II software version 6.6 (Applied Math, Sint-Martens-Latem, Belgium). The similarity pattern was calculated using the Unweighted-Pair Group Method (UPGMA)/the Dice similarity coefficient with a position tolerance of 1%. Isolates with more than 90% similarity were considered as a clonal type.

Amin M., Navidifar T., Saleh Shooshtari F, & Goodarzi H. (2019). Association of the genes encoding Metallo-β-Lactamase with the presence of integrons among multidrug-resistant clinical isolates of Acinetobacter baumannii. Infection and Drug Resistance, 12, 1171-1180.

+ Open protocol

+ Expand

Genetic Diversity of E. cloaceae Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genetic diversity of E. cloaceae isolates was evaluated using the ERIC-PCR [17] . The primer sequences used were ERIC-F (5′-ATGTAA GCTCCTGGGGATTCAC-3′) and ERIC-R (5′-AAGTAAGTGACTGGGGTGA GCG-3′). The PCR reaction was performed in the final volume of 20 μl. The amplification mixture consisted of 1U Taq DNA polymerase, 1.5 mM MgCl 2 , 200 μM dNTPs, 0.25 μM of each primer, 10× PCR buffer, 5 μl of template DNA, and distilled water up to a final volume of 20 μl. The amplification process was performed in Mastercycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany) with one cycle of initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 60 s, annealing at 55 °C for 60 s, extension at 72 °C for 90 s, with a cycle of final extension at 72 °C for 10 min. The amplified products were resolved on agarose gel 1.5%, stained with 0.5 μg/ml ethidium bromide. The data analysis was performed using the Gel Compare II software version 6.6 (Applied Maths, Sint-Martens-Latem, Belgium). The similarity pattern was calculated using the Unweighted-Pair Group Method (UPGMA)/the Dice similarity coefficient with a position tolerance of 1.5%. Isolates with more than 80% similarity were considered an as clonal type.

Amin M., Mehdipour G, & Navidifar T. (2019). High distribution of 16S rRNA methylase genes rmtB and armA among Enterobacter cloacae strains isolated from an Ahvaz teaching hospital, Iran. Acta microbiologica et immunologica Hungarica, 66(3).

+ Open protocol

+ Expand

ERIC-PCR Genotyping of Acinetobacter baumannii

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genetic relatedness of A. baumannii isolates was evaluated in our previous study [12] using the ERIC-PCR with primers ERIC-F (5′-ATGTAAGCTCCTGGGGATTCAC-3′) and ERIC-R (5′-AAGTAAGTGACTGGGGTGA GCG-3′) [16] . Briefly, the PCR reaction was performed in the final volume of 25 μl containing 1U Taq DNA polymerase, 1.5 mM of MgCl 2 , 200 μM of dNTPs, 0.5 μM of each primer, 10× PCR buffer, 6.5 μl of template DNA, and distilled water up to a final volume of 25 μl. The amplification process was performed in Mastercycler Nexus Thermal Cycler Gradient (Eppendorf, Hamburg, Germany) with one cycle of initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 60 s, annealing at 57 °C for 60 s, extension at 72 °C for 80 s, and a cycle of final extension at 72 °C for 10 min. The amplified products were visualized on 1.5% agarose gel, stained with safe stain. The data analyses were performed using the Gel Compare II software version 6.6 (Applied Math, Sint-Martens-Latem, Belgium). The similarity pattern was calculated using the unweighted-pair group method/the Dice similarity coefficient with a position tolerance of 1%. Isolates with more than 90% similarity were considered as a clonal type.

Shooshtari F.S., Navidifar T., Amin M, & Goodarzi H. (2019). Coexistence of genes encoding aminoglycoside modifying enzymes among clinical Acinetobacter baumannii isolates in Ahvaz, Southwest Iran. Acta microbiologica et immunologica Hungarica, 67(1).

+ Open protocol

+ Expand

Quantifying HIV Transcript Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA and genomic DNA were isolated from cells using Trizol reagent (Life Technologies) according to the manufacturer’s instructions. cDNAs were synthesized from total RNA using SuperScript II reverse transcriptase (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed on 50 ng cDNA or 10 ng genomic DNA in a total volume of 25 μl using Taq DNA polymerase (New England Biolabs) and a Mastercycler Nexus Gradient thermal cycler (Eppendorf) using the following conditions: 95°C for 30 sec., 30-35 cycles of 95°C for 30 sec., 50°C for 30 sec., and 68°C for 30 sec., and 68°C for 5 min. PCR Primer sequences are detailed in Table S1. A schematic of amplicon locations within HIV for the detection of total, unspliced, and multiply spliced species are provided in Figure S2. For qPCR, RNA was isolated from cells using the RNAeasy Mini RNA Extraction Kit (Qiagen) per manufacturer’s instructions and treated with Turbo DNase (Thermo Fisher), also per the manufacturer’s instructions. cDNA was synthesized from 500 ng total RNA using the Superscript III First Strand cDNA Synthesis System (Thermo Fisher), per the manufacturer’s instructions. qPCR was performed using a Bio-Rad CFX 96 Real Time PCR System with Bio-Rad CFX data analysis software to determine copy number, with TATA-binding protein as a normalizer.

Burch B.D., Garrido C, & Margolis D.M. (2016). Detection of Human Immunodeficiency Virus RNAs in living cells using Spinach RNA aptamers. Virus research, 228, 141-146.

+ Open protocol

+ Expand

Quantitative RT-PCR for ABCB1 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA from DLD-1 cells was isolated and purified using PureLink RNA Mini Kit and PureLink DNase as recommended by the manufacturer. The RNA was quantified using Infinite 200 PRO NanoQuant (Tecan, Switzerland). cDNA was prepared from 1.5 µg total RNA by reverse transcription using SuperScript VILO MasterMix for RT-qPCR according to the manufacturer's instructions. cDNA was also quantified using Infinite 200 PRO NanoQuant. The mastermix for rtPCR was prepared by using nuclease free water, dNTP, MgSO₄, PCR buffer and PlatinumTaq DNA Polymerase. For ABCB1 gene, the forward and reverse primers were 5′ CGAGGTCGGAATGGATCTTG 3′ and 5′ GCCATTCTGAAACACCACT 3′, whereas for reference gene GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) the forward and reverse primers were 5′ ACCACAGTCCATGCCATCAC 3′ and 5′ TCCACCACCCTGTTGCTGTA 3′, respectively. The RT-PCR was carried out in Eppendorf Mastercycler Nexus Gradient Thermal Cycler (Hamburg, Germany). Amplification products were resolved by 1% agarose gel electrophoresis at 90 V for 60 min in TAE (Tris-acetate-EDTA) buffer and visualized by ethidium bromide staining. The images of the gel were taken by an image reader (Fujifilm LAS-3000, Tokyo, Japan). The densitometric analysis was performed using ImageJ software.

Amjad M.W., Mohd Amin M.C., Mahali S.M., Katas H., Ismail I., Hassan M.N, & Chuang V.T. (2014). Nanoscale Diblock Copolymer Micelles: Characterizations and Estimation of the Effective Diffusion Coefficients of Biomolecules Release through Cylindrical Diffusion Model. PLoS ONE, 9(8), e105234.

+ Open protocol

+ Expand

CRISPR Off-Target Site Analysis for Rice

Check if the same lab product or an alternative is used in the 5 most similar protocols

The potential off-targets of sgRNAs were predicted using the “offTarget” program in the CRISPR-GE software toolkit [52 (link)]. Genomic DNA of rice was extracted using the CTAB (cetyl trimethylammonium bromide) method. The DNA fragments covering the on-target and off-target sites were amplified by PCR using the specific genomic primers. PCR amplifications were performed in a Mastercycler nexus gradient thermal cycler (Eppendorf, Hamburg, Germany). Each reaction contained DNA templates, 1 × PCR buffer, 0.4 mmol L⁻¹ dNTPs (deoxynucleotide triphosphates), 0.3 μmol L⁻¹ of both forward and reverse primers, and 1 U KOD FX DNA polymerase (Toyobo, Osaka, Japan). Distilled water was added to a final volume of 50 μL. The PCR conditions included an initial incubation at 94 °C for 2 min, followed by 30 cycles of 98 °C for 10 s, 50–55 °C for 30 s, and 68 °C for 0.5–1 min, with a final extension at 68 °C for 5 min. The amplified products were sequenced directly. For some samples, PCR products were cloned and individual clones were sequenced. The superimposed sequencing chromatograms of heterozygous and bi-allelic mutations were decoded using DSDecodeM [53 (link)]. The PCR primers used are listed in Table S9.

Gao Q., Li G., Sun H., Xu M., Wang H., Ji J., Wang D., Yuan C, & Zhao X. (2020). Targeted Mutagenesis of the Rice FW 2.2-Like Gene Family Using the CRISPR/Cas9 System Reveals OsFWL4 as a Regulator of Tiller Number and Plant Yield in Rice. International Journal of Molecular Sciences, 21(3), 809.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!