To measure the mRNA levels of the target genes, total RNAs were isolated using Qiagen lysis solution (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. cDNAs were synthesized from 1 μg of total RNA of each sample using the GoScript Reverse Transcription system (Promega). Quantitative Real-time PCR was then performed with Light-Cycler 1.5 (Roche Diagnostics, Mannheim, Germany) using QPCR SYBR Green Capillary Mix (ABgene, Surrey, UK). The primer sequences used for amplification of the target genes are listed in Table 1 .
Lysis solution
Manufactured by Qiagen
Sourced in United States, Germany
The Qiagen lysis solution is a reagent designed to disrupt and lyse cells or tissues, releasing their intracellular contents for further analysis. It is a key component in many nucleic acid extraction and purification protocols.
Automatically generated - may contain errors
Lab products found in correlation
Goscript reverse transcription system, by Promega (4 mentions)
Lightcycler 1, by Roche (3 mentions)
Qpcr sybr green capillary mix, by Thermo Fisher Scientific (2 mentions)
Light cycler 2, by Thermo Fisher Scientific (2 mentions)
Absolute qpcr sybr green capillary mix ab gene system, by Thermo Fisher Scientific (2 mentions)
Absolute qpcr sybr green capillary mix system, by Thermo Fisher Scientific (1 mentions)
Absolute qpcr sybr green capillary mix, by Thermo Fisher Scientific (1 mentions)
Lightcycler 2, by Roche (1 mentions)
7 protocols using lysis solution
1
Quantitative Real-time PCR Protocol
2
Measuring Target Genes mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the mRNA levels of the target genes, total RNAs were isolated using Qiagen lysis solution (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and cDNAs were synthesized from 1 μg of total RNA of each sample using the GoScript Reverse Transcription system (Promega). Quantitative Real-time PCR was then performed with LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) using QPCR SYBR Green Capillary Mix (ABgene, Surrey, UK) at 95°C for 15 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec. The primer sequences used for amplification of the target genes are listed in Table 1 . The amount of target mRNA was measured via the comparative threshold (Ct) method after normalizing target mRNA Ct values to those for glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ΔCt) as a housekeeping gene. The sequences of the siRNA used are listed in (Table 1 ).
3
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the mRNA levels of target genes, total RNA was isolated from cells by Qiagen lysis solution (Qiagen, Maryland, USA) and transcribed into cDNA by Go Script reverse transcription process (Promega) according to the manufacturer's instructions and as described previously67 (link). Quantitative real time-PCR was then performed using a Light Cycler 2.0 (Mannheim, Germany) using absolute QPCR SYBR green capillary mix system (Thermo Scientific, UK) at 95 °C for 15 min, with successive 40 cycles of 95 °C for 15 s, 56 °C for 30 s, and 72 °C for 45 s. The mRNA level of target gene was normalized to the value of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The sequences of the primers used for the PCR amplification are listed in Table 1 .
Sequences of primers used in quantitative PCR.
| Target gene | Primer | Nucleotide sequence |
|---|---|---|
| p62 | F | 5′-GCTCAGGAGGAGACGATGAC |
| R | 3′- AGAAACCCAAGGACAGCATC | |
| TNF-α | F | 5′-CCCTCACACTCAGATCATCTTCT-3′ |
| R | 5′-GCTACGACGTGGGCTACAG-3′ | |
| GAPDH | F | 5′-ACCACAGTCCATGCCATCAC-3′ |
| R | 5′-TCCACCACCCTGTTGCTGTA-3′ | |
| IL-1β | F | 5′-GCCTCGTGCTGTCGGACCCATAT |
| R | 3′-TCCTTTGAGGCCCAAGGCCACA | |
| IL-6 | F | 5′-ACAACCACGGCCTTCCCTACTT |
| R | 3′-CACGATTTCCCAGAGAACATGTG | |
| IFN-β | F | 5′-AACTCCACCAGCAGACAGTG |
| R | 3′-TGAGGACATCTCCCACGTCA | |
| Nrf2 | F | 5′-CTCGCTGGAAAAAGAAGTG |
| R | 3′-CCGTCCAGGAGTTCAGAGA | |
| p21 | F | 5′-AATACCGTGGGTGTCAAAGC |
| R | 3′-GTGTGAGGACTCGGGACAAT | |
| T-Cad | F | 5′-TGCTGAAGACATGGCAGAAC |
| R | 3′-GGCTGACTCTGGTTCTCTGG |
4
Quantifying IL-1β mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure IL-1β mRNA levels, total RNA was isolated using Qiagen lysis solution (Qiagen, Frederick, MD, USA) according to the manufacturer’s instruction. Total RNA was reverse transcribed into cDNA, and quantitative real time PCR (qPCR) was then performed using ABsolute qPCR SYBR Green Capillary Mix (Thermo Scientific, Renfrew, UK) at 95 °C for 15 min, followed by 40 cycles at 95 °C for 15 s, 56 °C for 30 s, and 72 °C for 45 s. The amount of target mRNA was analyzed using the comparative threshold (Ct) method after normalizing the target mRNA Ct values to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ΔCt). The primer sequences used for amplification were as follows. Forward primer; 5′-GCCTCGTGCTGTCGGACCCATAT-3′, Reverse primer 5′-TCCTTTGAGGCCCAAGGCCACA-3′.
5
Quantifying Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the measurement of mRNA levels of genes of interest, total RNAs were isolated using Qiagen lysis solution (Qiagen, Maryland, USA) according to the manufacturer's instructions. cDNA was then synthesized via reverse transcription of 1 μg of total RNA. Real time-PCR amplification was then performed with a Roche Light Cycler 2.0 (Mannheim, Germany) using the absolute QPCR SYBR green capillary mix AB gene system (Thermo scientific, UK) essentially as described previously [23 (link)]. The primer sequences used for amplification of target human genes are listed in Table 1 .
6
Quantitative Real-time PCR Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the measurement of mRNA levels of target genes, total RNAs were isolated by Qiagen lysis solution (Qiagen, Maryland, USA) according to the manufacturer's instruction. Isolated total RNA was reverse transcribed into cDNA using Go Script reverse transcription system (Promega). Quantitative Real time-PCR was then performed using Light Cycler 2.0 (Mannheim, Germany) with the use of absolute QPCR SYBR green capillary mix AB gene system (Thermoscientific, UK) at 95°C for 15 s, 56°C for 30 s, and 72°C for 45 s. The amount of target mRNA was analyzed via comparative threshold (Ct) method after normalizing target mRNA Ct values to that for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ΔCt). The primer sequences used for amplification of target genes are listed in Table 1 .
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment with LPS and/or YJI-7, total cellular RNA was extracted using Qiagen lysis solution (Qiagen, Hilden, Germany). Two hundred to three hundred nanograms of total RNAs were reverse transcribed into cDNA using the GoScript reverse transcription system (Promega) as previously described (Nepal and Park, 2013 (link)). Quantitative real-time PCR was then performed with LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) by using a qPCR SYBR Green Capillary Mix. The conditions for PCR amplification were as follows; 95°C for 15 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s and 72°C for 30 s. The amount of target mRNA was determined via comparative threshold (Ct) method. Then, the value was normalized to the value of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. The sequences of the primers used are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!