To confirm the expression pattern of the characteristic genes in MM more precisely, bone marrow fluids of 14 MM patients and 14 normal samples were used for this study. 500ul of each sample was taken separately, and all intracellular RNA was extracted by Trizol reagent, and the quality of the extracted RNA were detected by nanodrop (Thermo scientific). The extracted RNA was reverse transcribed to cDNA according to manufacture instructions to detect the following targets expression. The BlazeTaq™ SYBR® Green qPCR Mix2.0 kit (Genecopoeia) and the following reaction system were uutilized to perform qRT-PCR reactions next. Primer sequences are shown in Table S1 . The CT values of each gene were counted, and the relative expression of characteristic genes was analyzed according to the 2-ΔCt method using GAPDH as the internal reference gene.
Blazetaq sybr green qpcr mix2.0 kit
Manufactured by GeneCopoeia
Sourced in United States, China
BlazeTaq™ SYBR® Green qPCR Mix2.0 kit is a ready-to-use solution designed for quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including SYBR® Green dye, for the detection and quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Surescript first strand cdna synthesis kit, by GeneCopoeia (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Real time quantitative pcr instrument cfx96, by Bio-Rad (1 mentions)
4 protocols using blazetaq sybr green qpcr mix2.0 kit
1
Quantifying Characteristic Genes in Multiple Myeloma
2
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HPAEpiC and NCI-H146 cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The concentration and quality of RNA were determined by spectrophotometry (Jinghua Technology) at 260 and 280 nm. Total RNA was reverse transcribed using the SureScript™ First-Strand cDNA Synthesis Kit (Genecopoeia, Inc.) according to the manufacturer's protocol. RT-qPCR was performed using the CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.) using the BlazeTaq™ SYBR®-Green qPCR Mix 2.0 kit (Genecopoeia, Inc.) according to the manufacturer's instructions. The thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles that each involved incubation at 95°C for 10 sec, 60°C for 20 sec and 72°C for 30 sec. Relative expression values were calculated using the 2−Δ∆Cq method (15 (link)). The primers were synthesized by TsingKe Biological Technology and their sequences are listed in Table I .
3
Quantifying Expression of Hub Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Nuclezol LS RNA Isolation Reagent (ABP Biosciences, Inc). cDNA was synthesized using 1.0 ug of total RNA with the SureScript-First-strand-cDNA-synthesis-kit (GeneCopoeia, Guangzhou). Quantitative PCR was performed for hub genes using the BlazeTaq™ SYBR ® Green qPCR Mix 2.0 kit (GeneCopoeia) with the CFX96 real time quantitative PCR instrument (Bio-Rad, USA). The relative expression levels were determined by the 2−ΔΔCt method and normalized to internal control GAPDH. All qPCR reactions were performed in triplicate. The primers designed by Qingke Biology Co., Ltd are listed as below: FCN3-F: CAGGATGGTTCTGTGGATTT; FCN3-R: TCAGCGTCATAGGTGGTAAA; FOXO1-F: CTTCTGACTCTCCTCCCCACA; FOXO1-R: CCCATCCTACCATAGCCATTG; GAPDH-F: CGCTGAGTACGTCGTGGAGTC; GAPDH-R: GCTGATGATCTTGAGGCTGTTGTC.
4
qRT-PCR Analysis of Cardiac Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from right atrial tissue with TRIzol Reagent (Life Technologies, CA, USA). Reverse transcription was conducted using SureScript-First-strand-cDNA-synthesis-kit (GeneCopoeia, Guangzhou, China). qPCR was conducted using a BlazeTaq™ SYBR® Green qPCR Mix 2.0 kit (GeneCopoeia, Guangzhou, China) following the instructions. The thermocycling conditions were as follows: initial activation at 95°C for 30 s, followed by 40 cycles at 95°C for 10 s, 60°C for 20 s and 72°C for 30 s. GAPDH was used as the internal reference for the mRNA for data normalization. The relative expression was calculated by 2−ΔΔCt method. Primers are available in Table 1 .
Primer Sequences for qRT- PCR
| Gene Names | Forward (5ʹ-3ʹ) | Reverse (3ʹ-5ʹ) |
|---|---|---|
| CDKN1A | TGAGTTGGGAGGAGGCAG | GAGCGAGGCACAAGGGTA |
| DAPK2 | GAGAGGAGCTGGGGAGTGG | GCTTGATGTGTGGAATGGG |
| DIRAS3 | ACGCCTTCGTCCTGGTCTAC | GGGCATCTGGGATTTCTTCT |
| HSP90AB1 | GAACTAAACAAGACCAAGCC | TCCTCAGAGTCAACCACACC |
| IFNG | CATCGTTTTGGGTTCTCTTG | TTTTTCGCTTCCCTGTTTTA |
| ITGA3 | GTAGGAAGCCCCCTCAAG | GGGTAGCCCAGCCATTTA |
| PRKCD | TACGAGATGCTCATTGGC | GTCTTGAAGAAGGGGTGG |
| PTK6 | CGTCTGGTCCTTTGGGATTCTC | GTCGGGTTCTCGTAGCTGGTGA |
| TNFSF10 | AGCAACACATTGTCTTCTCCA | TAAGCTCAAATATTCCCCCTT |
| TP53INP2 | AAAGAAAACACAAAGAACGACAA | ACTAAAAAGGCCCCAAAAAAACT |
| CXCR4 | AGCAAGGGTGTGAGTTTGAGA | GAAAGCATAGAGGATGGGGTT |
| GAPDH | CGCTGAGTACGTCGTGGAGTC | GCTGATGATCTTGAGGCTGTTGTC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!