Dextran texas red 70 000 mw

Upon thermal-cycling, amplified DNA-containing droplets were reinjected into a droplet fusion device where they were synchronized and fused with larger 17 pl on-chip produced droplets (generated as described in (45 (link)) containing an in vitro expression mixture made of 3 mM of the 20 amino acids, 1 U/μl RNasin^® (Promega), 500 μM of the four NTP, 3 mM MgCl₂, 80 mM KCl, 30 μl/ml Dextran Texas-Red 70 000 MW (Thermofisher), 50 μg/ml of T7 RNA polymerase purified in the lab and half of a volume of Rabbit Reticulocyte Lysate prepared as previously described (48 (link)). Pairwise droplets were fused, the emulsion was collected as described before (45 (link)) and incubated for 3 h at 30°C.

First, DNA molecules were individualized into 2.5 pl PCR mixture-containing droplets by diluting the DNA solution such that only 1 out 10 droplets initially contained a DNA molecule to limit multiple encapsulation events. To do so, a PCR mixture containing 0.13 pM of template DNA diluted into 200 ng/μl yeast total RNA (Ambion), 0.2 μM of FwdIRES-GFP (5′GTCGTCTAATCCAGAGACCCCGGATCGG3′) and RevGFP (5′ GAAGCGGCCGCTCTAGATTAATTTAAATC3′) primers, 0.2 mM of each dNTP (Thermofisher), 0.1% Pluronic F68 (Gibco), 0.7 mg/ml Dextran Texas-Red 70 000 MW (Thermofisher), Phire Hot Start II DNA polymerase (Thermofisher) and the corresponding buffer at recommended concentrations was dispersed into 2.5 pl droplets carried by a Novec7500 fluorinated oil (3M) supplemented with 3% of fluorosurfactant as described before (44 (link)). The emulsion was collected and thermocycled as above.