LR73 cells were incubated with apoptotic Jurkat cells for 2h, washed 3 times with PBS and incubated with 10 mM 2-deoxygloucs (2-DG), a glucose analog, in glucose free media for 30 min. Following incubation, cells were washed 3 times with PBS and lysed with Extraction Buffer (Sigma Cat#: MAK083). Lysate was frozen/thawed in dry ice/ethanol, and then heated at 85°C for 40 min. Lysate was then cooled on ice for 5 min and then neutralized by Neutralization Buffer (Sigma Cat#: MAK083). Samples were spun down at 13,000x g to remove insoluble fraction and then diluted 10-fold by adding Assay Buffer. Using the lysate, glucose uptake was measured using Glucose Uptake Colorimetric Assay Kit (Sigma). 2-DG is taken up by cells and phosphorylated by hexokinase to 2-DG6P. 2-DG6P cannot be further metabolized and accumulates in cells, directly proportional to the glucose uptake by cells. 2-DG uptake is determined by a coupled enzymatic assay in which the 2-DG6P is oxidized, resulting in the generation of NADPH, which is then determined by a recycling amplification reaction in which the NADPH is utilized by glutathione reductase in a coupled enzymatic reaction that produces glutathione. Glutathione reacts with DTNB to produce TNB, which was detected at 412 nm as per the manufacturer’s recommendations.
Neutralization buffer
Manufactured by Merck Group
Neutralization Buffer is a laboratory product designed to maintain a specific pH level in chemical reactions. It is used to adjust the acidity or basicity of solutions, ensuring optimal conditions for various experimental processes. The core function of Neutralization Buffer is to provide a stable and consistent pH environment to facilitate the desired chemical reactions or analyses.
Automatically generated - may contain errors
Lab products found in correlation
Glucose uptake colorimetric assay kit, by Merck Group (2 mentions)
Extraction buffer, by Merck Group (2 mentions)
Big dye protocol, by Thermo Fisher Scientific (1 mentions)
Lipofectamine crisprmax cas9 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Mammalian genomic dna miniprep kit, by Merck Group (1 mentions)
Cas9 protein, by Thermo Fisher Scientific (1 mentions)
Lysis solution, by Merck Group (1 mentions)
Kapa2g taq polymerase, by Roche (1 mentions)
3 protocols using neutralization buffer
1
Glucose Uptake Measurement in Apoptotic Cells
2
Generation of Ndufs3 Knockout B16-F10 Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 system was used to introduce a frameshift mutation in Ndufs3 gene in B16-F10 murine melanoma cell line. In detail, Cas9 protein (Invitrogen #A36497) was transfected following manufacturer’s instructions using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen #CMAX00015) together with synthetic RNA guides designed by Deskgen and purchased from Synthego. Exon 3 targeting guide TTGTGGGTCACATCACTCCG with PAM sequence GGG was used. Cells were split 48 hours after transfection and DNA was extracted using Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich #G1N350). Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451). In particular, 61°C annealing temperature was used for the PCR reaction, with primers forward CTGTAACTCCAGTCTCAGGGA and reverse CACACTGCAGGGATCACTTG. Manual clonal selection was performed in order to identify the cells with frameshift Ndufs3 mutations, leading to the generation of a pool of clones carrying the homozygous c.148A>G and c.150_151insCT mutations. DNA extraction from 96-well plates was performed using 8 μL of Lysis Solution (Sigma-Aldrich #L3289) and 80 μL of Neutralization Buffer (Sigma-Aldrich #N9784) per sample, following manufacturer’s instructions.
3
Glucose Uptake Measurement in Apoptotic Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!